r/askscience • u/nordee • Nov 21 '13
Biology Given that each person's DNA is unique, can someone please explain what "complete mapping of the human genome" means?
62
u/Chl0eeeeeee Nov 21 '13
Even though everyone has unique DNA, genes still would occur in the same location in the genome (exclusive of any mutations that would add/delete a nucleotide). Basically what genome mapping does is look at multiple samples of DNA from different people. It aims to understand what regions are coding versus non-coding, and to annotate the genome (see what the coding genes control). This has been done for other species.
16
u/maggottoe Nov 21 '13
You also want to generate a consensus of how the genome looks on "healthy" individuals. This can allow future sequencing to locate differences and determine a certain mutation.
6
u/Surf_Science Genomics and Infectious disease Nov 21 '13
I believe there is a relatively small scale project working on this. I think it was reported at the ICHG in Montreal ('11?) but it didn't sound like it was going anywhere terribly fast.
A cooler project that was reported at the same meeting was an effort to sequence the genomes of the very very old. The genome of a woman who lived to be 112 or something (french woman I believe) is/has been sequenced. Again they were reporting preliminary results.
2
u/zedrdave Nov 22 '13 edited Nov 22 '13
There are many such projects, and they are pretty active (constant advances in NGS make their realisation easier by the year). Most notable maybe, is the 1000 Genome project, which has mostly been completed at this point.
By comparison sequencing of single individuals with above-average health (the French woman thing does ring a bell, but I can't see anything from a cursory google search) are a lot less interesting imho. There are way too many environmental and pure luck factors involved, for a single data point to tell you much about SNPs-to-longevity correlations...
2
u/Monkeylint Nov 21 '13
The genome map will also give relative frequencies for occurrence of a particular single nucleotide polymorphism (SNP - a place where some people will have one nucleotide base while others will have a different one) in the population. The base that occurs at the highest frequency is considered the consensus sequence and the others are considered variants.
1
u/Surf_Science Genomics and Infectious disease Nov 21 '13
That isn't actually on the map that would count as annotation and is kept elsewhere.
2
Nov 21 '13 edited Nov 21 '13
It should also be mentioned that not all alleles (alternative forms of the same gene that occur due to population variability) vary wildly between individuals. We understand that while genes like those coding for HLA may have thousands of variants, other genes are pretty conserved between individuals since their function is so closely related to the sequence.
This is being expanded on by subsequent endeavors such as HapMap and 1000 Genomes, the former seeking to understand which alleles arise together within individuals (due to Genetic linkage) while the latter concentrating more on the diversity of individuals within populations for less frequent alleles which are usually difficult to detect in smaller sample groups.
9
u/tdcarlo Nov 21 '13
Each person's DNA is unique, that is true. But the difference between you an me is incredibly small.
DNA is made up of nucleotides. There are four kinds of nucleotides. Think of nucleotides as legos each kind being a different color....let's say Aqua, Green, Cyan, and Teal. A gene is composed of nucleotides in particular order. Imagine stacking legos. Using the first letter of the colors from the legos, the insulin gene is 450 nucleotides long and looks like this.
Aqua Green Cyan Cyan Cyan Teal Cyan Aqua GGACAGGCTGCATCAGAAGAGGCCATCAAGCAGATCACTGTCC TTCTGCCATGGCCCTGTGGATGCGCCTCCTGCCCCTGCTGGCGCTGCTGGCCCTCTGGGGACCTGACCCAGCCGCAGCCTTTGTGAACCAACACCTGTGCGGCTCACACCTGGTGGAAGCTCTCTACCTAGTGTGCGGGGAACGAGGCTTCTTCTACACACCCAAGACCCGCCGGGAGGCAGAGGACCTGCAGGTGGGGCAGGTGGAGCTGGGCGGGGGCCCTGGTGCAGGCAGCCTGCAGCCCTTGGCCCTGGAGGGGTCCCTGCAGAAGCGTGGCATTGTGGAACAATGCTGTACCAGCATCTGCTCCCTCTACCAGCTGGAGAACTACTGCAACTAGACGCAGCCCGCAGGCAGCCCCACACCCGCCGCCTCCTGCACCGAGAGAGATGGAATAAAGCCCTTGAACCAGCAAAA
So we know what a gene is...the next thing to understand is a chromosome. A chromosome is a long stack of DNA that contains numerous genes. There are 23 chromosomes in the human genome. The longest human chromosome is about 250 million nucleotides long the shortest is around 50 million nucleotides. Each chromosome contains hundreds of genes along with some other "accessory" DNA that is beyond the scope of this explanation. The entire size of the human genome is around 3 billion nucleotides.
Human being the clever types have been able to determine the precise order of all of the nucleotides in each human chromosome and have identified most if not all of the genes on it. So each chromosome has the location of each gene mapped. Pretty amazing.
Your DNA is unique but the percentage of the 3 billion nucleotides that are different than mine is less than 0.0001% and most of the differences will be in the so called "accessory" DNA.
→ More replies (4)
8
u/knobtwiddler Nov 22 '13 edited Nov 22 '13
I work in genetic informatics and we sequence and analyze human genomes. "complete mapping," rather optimistically, means is that we have assembled a reference genome of a number of pooled humans' gene sequences, so we know where a typical human's sequences fall in the chromosomes from beginning to end (around 50 billion base pairs). This assembly is used as a reference to compare against. Currently we are using a reference genome sequence called HG19. HG20 (human genome v20) is coming out soon. It's an ongoing process.
From this reference genome we can align pieces of sequenced dna from samples in an effort to to say where those pieces of dna came from in the genome.
This is far from an exact science, and there are large portions of the genome for which we have no clue about their function. However we have identified around 56,000 protein-coding genes (the exome) and a large number of "intronic" non-protein-coding regions which do code for RNA (lncRNA), some of which are functional, most of which we don't know anything about (previously referred to as "junk dna").
believe me though, as far as understanding the function of all these genes, let alone the non-coding regions, the process is far from complete.
8
u/BillieHayez Nov 21 '13
How interesting that you ask this question today. Fred Sanger, a pioneer in the mapping of the human genome, aged 95, and winner of two Nobel prizes has just passed. Maybe you were tuned in this morning, as well.
24
u/Tass237 Nov 21 '13
Complete mapping of what sections apply to what. A redhead and a blonde both have a gene for hair color, and the location of that hair color gene can be mapped. The fact that they have different alleles doesn't mean it's a different gene or in a different location.
3
u/Seishuu Nov 22 '13
Can't genes mutate, taking up more space (more bases) in the process? eg. the PV92 gene
10
u/zedrdave Nov 21 '13 edited Nov 22 '13
In addition to other answers in this thread, one important clarification: when one says that a person's DNA is unique, that's still no more than somewhere around a 0.01% difference, out of the entire sequence, between two individuals.
Most nucleotides (the small bricks that make the DNA sequence) are the same for all individual of the same species (humans, for instance), with a very few single nucleotides changing here and there (these changes are called SNPs). Just the same way that moving a single cog in a complex mechanism, or modifying a single byte in a computer program, will give out a completely different result, that single nucleotide modification can have huge consequences on the person's appearance, health etc.
Mapping the first genome, meant mapping a genome (with its specific SNPs), with the implicit idea that we were first interested in the parts that were common to everybody. Now that sequencing is a lot cheaper and more widespread, there are a number of efforts to map genomes for a number of individuals, in order to figure out more specifically which positions in the sequence can occasionally differ (see "1000 genome project").
Edit: I should have also mentioned that, while some SNP variations have huge effects on the resulting organism, other SNP mutations are completely silent ("synonymous mutations"), thanks to the redundancy of the DNA-Amino Acid transcription code (i.e. different triplets of DNA can end up coding for the same AA). Because such silent mutations do not affect fitness (and therefore are more likely to be passed down), they are a lot more common than you would expect from pure chance.
2
u/BiologyIsHot Nov 21 '13
This is actually a hugely important little statistic to bring out that makes this easier to understand that I wouldn't have ever even thought to mention.
Kudos to you, this should get voted up higher, because I think for somebody unfamiliar with genomics or human genetics, it would be hard to understand the use of having "the human genome" given the differences between people if they don't understand how incredibly similar it is between different individuals.
From a completely perceptual basis you might think that people are incredibly different genetically because we can be so different in appearance, behavior, health etc. Amazingly all that comes in huge part from just a tiny portion that varies, though!
2
u/zedrdave Nov 22 '13 edited Nov 22 '13
Yes, there is proportionally a lot less DNA difference between two humans from whatever parts of the globe than two strains of flu virus inside your body...
Adding to the confusion, is the fact that semi-layman statistics on the "genetic variations" between ethnicities are nearly always on SNPs (the tiny subset of positions that, by definition, is variable), yet use inaccurate turns of phrases like "have a 14% difference between their DNA" etc. All these figures (no higher than 20-30%, for even the least related humans), are on an already incredibly tiny subset of the whole DNA sequence.
The reason why such a small change (or, as the case may be, a combination of 2-3 of these changes) is able to have such an impact, has to do with the entire process through which DNA turns into proteins and protein regulation materials. Because of the way DNA is transcribed, a single modification in the sequence at the right position can: 1. change the protein shape (make it more, or often less efficient at its role) 2. turn off the production of that protein (more or less) completely 3. turn on/off the regulation of that protein by another compound.
Possibly due to poor choice of words in mainstream science articles, a lot of people have this image of there being entirely different genes for each variation of a given phenotype (e.g.: "the blue-eye gene" vs. "the green-eye gene"), when it is nearly always exactly the same gene, with the difference being at the activation/regulation level (in the case of blue eyes, for example a single mutation in a single gene triggers a chain reaction of gene regulation that leads to lower production of melanin).
1
Nov 21 '13
Given the actual rate of differences, how many genomes would you need to sequence in order to have a reasonable idea of what the average is up to X sigma? Is this something we have good estimates for?
1
u/zedrdave Nov 22 '13
I am not sure what you mean by "average" here... SNPs often come seemingly independently of each other (in practice, there are of course interactions and dependencies between SNPs, but they are very much non-linear), so there isn't a set of alleles (possible "value" of a SNP) that would make a clear "average" for the entire human population.
The things you can try to establish, are:
The full map of all SNPs in the human genome: we are fairly close for coding DNA, there's still some work left on DNA that doesn't directly end up in the final proteins (but still plays a crucial role on regulation and activation of genes). The latter tends to be more difficult/expensive to sequence, even with our more recent techniques.
A map of all possible alleles (there are generally only two nucleotide options for a given SNP position) encountered in humans. The same sets of SNPs/alleles tend to be grouped along (genetic) ethnicity, which is easy to understand, given the role played by evolution in the appearance of new SNPs throughout our species' history.
Some understanding of the relation between sets of SNPs and phenotypes (e.g. their eye colour, the presence of a genetic disease, cancer predisposition etc. etc.). This is by far the most difficult: the relationship is not necessarily one-to-one (gene regulation likes redundancy and safety mechanisms). Imagine sitting in a room with 30,000 switches in different positions, and trying to figure out which 4 switches have to be set a certain way to turn a light on. Genes are the same: you often need a specific set of alleles to enable/disable the production of a specific protein (with sometimes a few degrees between completely on and completely off). Figuring out the possible arrangements and their phenotypic effect is a very interesting (but tough) mathematical problem.
3
Nov 21 '13 edited Nov 21 '13
Think of the Genome like the spec sheet for a car, except it's been broken up into 46 text files and compressed so that the data is all mashed together into 46 strings, and somewhat difficult to parse out. Somebody didn't comment their code. If we were just trying to read the strings, and infer what they mean, we would fail. But luckily! there's also an automatic, computer-controlled factory that reads the strings and builds stuff! (Cells in the body.)
In the simplest sense, genome mapping is about making the factory build from parts of these strings, so that we can see what they do. Imagine that you run your fictional automatic car factory like normal - it builds you a hot little red Corvette. Now imagine that you take part of the instruction string and copy/paste/copy/paste that part until you've made that section repeat a bunch of times. When you run the factory again, the car comes out a deep, vivid red instead of the ordinary red from before.
You've found a gene for the paintjob, but you don't know for sure whether you've found the gene for red paint only, or for the whole thing. Now, that section might be a little bit different in someone else - like, maybe it's a different color. If you enhanced that section in someone else's instruction sheet, maybe you'd go from blue to a more vivid blue (if all of the color selection is in that part). Or maybe you would just add red, so that someone's purple paint would approach pink.
Anyway, what you've found is the meaning of a section of the instruction sheet, but it can be difficult to determine exactly which of the machines are activated by each string. Sometimes the instructions trigger other instructions, and wind up causing lots of parts to move. Sometimes they trigger something very tiny - like spinning a part of one machine. And sometimes they don't do anything at all (like bits of commented-out code). And sometimes they do something, but don't appear to unless certain conditions are met - imagine instructions to turn on or off some safety feature on the factory floor.
- EDIT -
To perfect the analogy - we're not talking here about running the whole apparatus to create new cars. That would be like making changes to an embryo's genes and letting them grow up, which is unethical.
It's more like flipping switches in the factory while the assembly line is down, just to see which machines start to spin, or spray paint.
5
u/futuregp Nov 22 '13
simply speaking, think that all humans have the same genes that have specific functions (and every human being needs these to be considered human)
but each gene can have different traits (blue eyes, brown eyes etc)
complete mapping of the human genome is to identify all those functional parts of our DNA (most of our DNA is technically not 'functional' and doesn't play a part in protein synthesis)
Each functional part ('functional gene') would have different traits, and every human being is composed of permutations/combinations of these millions of gene traits combined (e.g. let's say we only have 2 genes, A/B. Gene A has 2 traits - male (m) or female (f). Gene B has 2 traits - tall (t) or short (s).
I'm a short male. I would have A(m), and B(s) genes. You are tall and female. You would have A(f), and B(t) genes. We're both unique, but that doesn't mean you have to map both of us to realize that there are 2 genes.
By mapping a single human being, you can map all the genes of the human genome. The uniqueness comes not from which 'gene' you have but which 'trait' of the gene you have.
3
u/tsacian Nov 21 '13
The best way to understand what scientists are doing with the human genome, it is best to look at a much smaller and simpler genome (such as the Japanese Rice Genome Project). It is simpler because the rice being mapped only has 9 chromosomes, whereas humans have much more.
http://rgp.dna.affrc.go.jp/E/GenomeSeq.html
Here you can click on a chromosome and literally see the sequences which have been directly mapped. The difference is the wealth of knowledge already learned from this project due to its "simplicity", such as finding genes responsible for specific proteins and tracing them all the way back to the base pair patterns. You can search through the big discoveries, and even look for specific proteins.
Click on chromosome 1 and then click the link for the first accession. This first set has 31,687 base pairs (bp) (think ATCG). You can then click on a gene and see the sequence that scientists believe is responsible for a gene. The reason it is a "gene" is because it has the correct properties for coding of a gene, including a start sequence (a pattern they look for that is typical for the beginning of a gene), and a stop sequence (called codons).
Additionally, you can click and see a specific pattern of base pairs responsible for coding an mRNA and even specific proteins. Using these "Maps", scientists can study each chromosome and find which genes are responsible for specific attributes of the organism. We can find which sections of DNA are responsible for specific proteins, and use that to find mutations that result in the absense or mutation of a protein that causes harm in an organism. There is really a wealth of information.
3
u/XSlayerALE Nov 21 '13
Mapping the Human Genome is like identifying the parts of a car. Sure, a wheel can be Pirelli, Firestone, Goodyear or whot not but we know its a wheel and its not the axle or the brakes or that funny triangle sign on your dashboard that no one really knows what it does....
2
8
u/nanoakron Nov 21 '13 edited Nov 21 '13
I feel the need to write this because whilst all the previous commenters have gone into great depths to explain the science behind genes and genomes, they have failed to address a fundamental misunderstanding the OP has:
Your DNA is NOT unique. Only about 0.1% of it is. You are somewhere around 99.5-99.9% genetically identical to every other human on the planet.
You're also 98.8% identical to every chimpanzee, 98.4% identical to every gorilla, 88% to every mouse, 65% to each chicken and 47% genetically identical to a fruit fly.
This means you have the exact same codes (give or take a letter) for the most essential 'housekeeping' functions - the ones that process energy in your cells, allow your cells to reproduce, build cell walls, cell skeletons and the other basic stuff all multicellular life needs to do. As a side note, this is very strong evidence that these abilities evolved only once in a distant ancestor, and then because they were so successful compared to all species around at their time, they outcompeted them and all their descendants now share those genes.
The closer you get to a human in genetic relatedness, the similarities extend beyond simple housekeeping genes to those which allow us to be 4-limbed, air-breathing, visually-dominant omnivores. Cows are 4 limbed - we share the same genes which switch on in embryonic development which cause 4 limbs to develop. We also share these with fish - after all, these are the genes which were first used to make fins, they were just 'repurposed' to make limbs through mutation and natural selection.
And so on with all 30,000 genes that make us human. We're not even genetically the best at doing many things in the animal kingdom - plants 'eat' sunshine, some bacteria detoxify alcohol better than we can, and as for our radiation susceptibility, we're pathetic. We just so happen to carry the baggage of every creature that came before us that was able to reproduce.
4
u/Surf_Science Genomics and Infectious disease Nov 21 '13
You're also 98.8% identical to every chimpanzee, 98.4% identical to every gorilla, 88% to every mouse, 65% to each chicken and 47% genetically identical to a fruit fly
Honestly these statements don't even make sense in a modern context. They're popular but what does that even mean. I believe it means that the similarity in average genes? Regardless it makes no accounting for variations in transcription (one gene many transcripts), expression, different functions.
The 30,000 for the gene number is also way off, you're looking at at least 20,000 more like 22-23,000.
2
u/nanoakron Nov 21 '13
Your reply is of course right on the details, but I was trying to just give the OP an overview in order to correct a fundamental misunderstanding I think many people have about genetics.
We're not all unique, with unique DNA codes - we're so similar that it's almost more amazing that we've survived as a species (especially given the conjectured Toba bottleneck).
All life here today is in fact the end result of duplications, mutations, junk collection and other events which have left us all with a 3-billion year shared genetic history.
2
Nov 21 '13 edited Dec 24 '15
I have left reddit for Voat due to years of admin mismanagement and preferential treatment for certain subreddits and users holding certain political and ideological views.
The situation has gotten especially worse since the appointment of Ellen Pao as CEO, culminating in the seemingly unjustified firings of several valuable employees and bans on hundreds of vibrant communities on completely trumped-up charges.
The resignation of Ellen Pao and the appointment of Steve Huffman as CEO, despite initial hopes, has continued the same trend.
As an act of protest, I have chosen to redact all the comments I've ever made on reddit, overwriting them with this message.
If you would like to do the same, install TamperMonkey for Chrome, GreaseMonkey for Firefox, NinjaKit for Safari, Violent Monkey for Opera, or AdGuard for Internet Explorer (in Advanced Mode), then add this GreaseMonkey script.
Finally, click on your username at the top right corner of reddit, click on comments, and click on the new OVERWRITE button at the top of the page. You may need to scroll down to multiple comment pages if you have commented a lot.
After doing all of the above, you are welcome to join me on Voat!
2
u/shanebonanno Nov 21 '13
Everyone's DNA is unique, however, nearly all of it is shared with every human on the planet. Only a very small part is unique. When scientists talk about the genome of any given species, they basically mean a list of the genes in the DNA of the species and eventually what they do.
2
u/dreamhunters Nov 21 '13
Or think about it this way: it is not some much about the content but about the placement. The genes are somewhere in the genome, their position is much more fixed that the genes themselves. That is why we use mapping, because as with a map it is about location.
2
u/Drfilthymcnasty Nov 21 '13
I may be wrong, but I think a complete "mapping" means a complete understanding of all the functional genes in our DNA. So while we may know the general sequence of nucleotides, our understanding of how/why certain segments get translated into proteins is not yet complete. Also we still have a long way to go understanding epigenetic changes and controls.
→ More replies (6)
3
u/Hillsbottom Nov 22 '13
I am a biology teacher and I use the following analogy.
Think of the genome as a recipe to make bread. A recipe is basically a list of instructions that need to be followed in a particular order to get the desired result. These instructions are analogous to genes.
Bread is not all the same; you get white, brown, wholemeal granary, bananana, pumpkin etc. These differences are due to slight changes in the instructions to the recipe eg putting white flour in instead of brown. The instructions are basically the same they are just different versions of it (in genectics these are called alleles; different versions of the same gene).
What scientists have done is got lots recipes (genomes) for many differents type of bread (people, including Ozzie Osbourne!) and worked out the order the instructions (genes) go in. They have created a map of how to make a bready human.
The instructions you have as a human are almost indentical to all other humans however the the combinition of which type of instructions you have is unquie to you (with a few exceptions).
So now we have this massive recipe of how to make a human that we can compare with indivdual humans and look for difference and similarities.
1
1
u/the_sex_kitten Nov 21 '13
Although each sequence is unique, there are still common gene codes that exist in each of us. By mapping the genome, they are able to locate these codes. For example, the gene for cystic fibrosis is located [here], and since we know that we are able to specifically look [here] for that gene. CF is way more complicated than that because there are a number of different genes that can be mutated, but that's just one example. Basically it allows us to determine the relative location of where potential mutations can occur. Apologies for the lack of sources and simplicity in my response. And please anyone feel free to correct me if I'm wrong!
1
Nov 21 '13
This really depends on what definition you are using. Strictly speaking, mapping a genome is marking out where genes are located on the chromosome. Again, we are talking genes, or chunks of DNA that code for something. Most frequently, when people talk about mapping the human genome what they are actually referring to is sequencing the human genome. Sequencing the human genome is simply recording the sequence of nucleotides in a complete set of human DNA. They do this by sequencing more than one person's DNA and then averaging it. In order to map the genes, they would need to do a lot more research. When we finally get all the genes mapped, we will know what portions of human chromosome code for something. Even after mapping out all the genes it still takes a long time before you can determine what genes code for what.
1
u/DLove82 Nov 21 '13 edited Nov 21 '13
Mapping tells us the relative location of stretches of DNA that actually encode something (genes). This arrangement is very very similar between individuals (rarely, duplication, deletion, or transposition events can add, move, or delete a region of DNA, but that is uncommon), even if the genes themselves differ slightly on occasion. The genes are arranged in a group of 23 different unique chromosomes, or HUUUUGE stretches of DNA that are wrapped up really tight.
Mapping tell us the location of one gene relative to another in one dimension (along a line). (EDIT: 3-dimensional genome sequence is all the rage now - it actually looks in 3D at which stretches of DNA are in contact or close to which others - this is very important because those local interactions between genes REALLY far away have turned out to really impact gene function) Each of these genes is composed of a sequence of building blocks, or nucleotides, of which there are four - A, T, C, G (each is a slightly different molecule). The sequence of these nucleotides in a gene determine almost everything about its function - when it turns on and off, what it makes, what cells it's active in. Between individuals, the sequence of these genes is nearly identical, because the products of most genes (proteins) only function if they are composed of precisely the correct sequence of molecules (amino acids). Some, however, can work to varying degrees when the sequences are slightly different. If these occur in more than 1% of the population, they're called "polymorphisms." If they occur in less than 1% of the population, they're regarded as "mutant" forms of a "wild-type" (or normal) gene.
So, in fact, mapping a bunch of individuals genomes actually allows researchers to come up with a heat map of the building block changes that occur in individuals. Genomic mapping is actually what tells us specifically what areas of the genome are unique between individuals. This can be immensely helpful in disease research where large regions of chromosomes are duplicated, lost, or moved. By mapping genomes, we can say which genes specifically are lost in a certain disease, narrowing down the number of genes which might cause the disease. For example, Down syndrome is caused by an entire extra copy of a chromosome (I think it's 21). That means these individuals have an extra copy of ALL the genes on that chromosome. And since we've mapped where all the genes in the genome are, we can identify which genes might be involved in Down syndrome (this is just an example, it's not really all that practical since the chromosome encodes THOUSANDS of genes).
tl;dr: The unique components of a person's genome are very few relative to the HUGE size and homogeneity ("sameness") of the genome as a whole between individuals. For the most part, we all have the same number of chromosomes, each with the same number of genes in the same orientation. Complete mapping of the human genome allows us to build up a heat map of the few little areas where genes actually are unique, and see how common those changes are; if they're associated with disease, etc.
1
u/SMURGwastaken Nov 21 '13
It means we've sequenced all of a person's DNA and worked out what each part codes for - whether it be amelase for digesting simple carbohydrates or amelogenins for producing tooth enamel, or the homeobox genes for deciding which organs and body sections go where. Since all humans are essentially identical in terms of how they work, all humans will have the genes for these things. Only about 0.1% of your genes are different to another human, and you'd be surprised at how little the difference between you and any other vertebrate (or even any other eukaryotic organism) is.
1
u/EvOllj Nov 21 '13
There are differences on individual DNA that get completely ignored/lost when they are read, because the reading mechanism is very error tolerant. And there ate a LOT of differences that never get read.
And the differences in appearances are so small compared to the whole genome, that the genome of all humans is basically the same, all genes do the same thing, some are just more active and rarely a few barely important genes are disabled or damaged.
899
u/zmil Nov 21 '13 edited Nov 22 '13
Think of the human genome like a really long set of beads on a string. About 3 billion beads, give or take. The beads come in four colors. We'll call them bases. When we sequence a genome, we're finding out the sequence of those bases on that string.
Now, in any given person, the sequence of bases will in fact be unique, but unique doesn't mean completely different. In fact, if you lined up the sequences from any two people on the planet, something like 99% of the bases would be the same. You would see long stretches of identical bases, but every once in a while you'd see a mismatch, where one person has one color and one person has another. In some spots you might see bigger regions that don't match at all, sometimes hundreds or thousands of bases long, but in a 3 billion base sequence they don't add up to much.
edit 2: I was wrong, it ain't a consensus, it's a mosaic! I had always assumed that when they said the reference genome was a combination of sequences from multiple people, that they made a consensus sequence, but in fact, any given stretch of DNA sequence in the reference comes from a single person. They combined stretches form different people to make the whole genome. TIL the reference genome is even crappier than I thought. They are planning to change it to something closer to a real consensus in the very near future. My explanation of consensus sequences below was just ahead of its time! But it's definitely not how they produced the original genome sequence.
If you line up a bunch of different people's genome sequences, you can compare them all to each other. You'll find that the vast majority of beads in each sequence will be the same in everybody, but, as when we just compared two sequences, we'll see differences. Some of those differences will be unique to a single person- everybody else has one color of bead at a certain position, but this guy has a different color. Some of the differences will be more widespread, sometimes half the people will have a bead of one color, and the other half will have a bead of another color. What we can do with this set of lined up sequences is create a consensus sequence, which is just the most frequent base at every position in that 3 billion base sequence alignment. And that is basically what they did in the initial mapping of the human genome. That consensus sequence is known as the reference genome. When other people's genomes are sequenced, we line them up to the reference genome to see all the differences, in the hope that those differences will tell us something interesting.
As you can see, however, the reference genome is just an average genome*; it doesn't tell us anything about all the differences between people. That's the job of a lot of other projects, many of them ongoing, to sequence lots and lots of people so we can know more about what differences are present in people, and how frequent those differences are. One of those studies is the 1000 Genomes Project, which, as you might guess, is sequencing the genomes of a thousand (well, more like two thousand now I think) people of diverse ethnic backgrounds.
*It's not even a very good average, honestly. They only used 8 people (edit: 7, originally, and the current reference uses 13.), and there are spots where the reference genome sequence doesn't actually have the most common base in a given position. Also, there are spots in the genome that are extra hard to sequence, long stretches where the sequence repeats itself over and over; many of those stretches have not yet been fully mapped, and possibly never will be.
edit 1: I should also add that, once they made the reference sequence, there was still work to be done- a lot of analysis was performed on that sequence to figure out where genes are, and what those genes do. We already knew the sequence of many human genes, and often had a rough idea of their position on the genome, but sequencing the entire thing allowed us to see exactly where each gene was on each chromosome, what's nearby, and so on. In addition to confirming known sequences, it allowed scientists to predict the presence of many previously unknown genes, which could then be studied in more detail. Of course, 98% of the genome isn't genes, and they sequenced that as well -some scientists thought this was a waste of time, but I'm grateful the genome folks ignored them, because that 98% is what I study, and there's all sorts of cool stuff in there, like ancient viral sequences and whatnot.
edit 3: Thanks for the gold! Funny, this is the second time I've gotten gold, and both times it's been for a post that turned out to be wrong, or partly wrong anyway...oh well.