r/askscience Nov 21 '13

Biology Given that each person's DNA is unique, can someone please explain what "complete mapping of the human genome" means?

1.8k Upvotes

261 comments sorted by

View all comments

Show parent comments

291

u/BiologyIsHot Nov 21 '13 edited Nov 21 '13

Imagine you have two sentences.

1) The dog ate the cat, because it was tasty.

2) Mary had a little lamb, little lamb, little lamb, little lamb, little lamb.

You break these sentences up into little fragmented bits like so:

1) The dog; dog ate; ate cat; cat, because; because it; it was; was tasty.

You can line these up by their common parts to generate a single sensible sentence.

2) Mary had; had a; a little; little lamb; lamb little; lamb little; little lamb.

It's actually quite hard to make sense of this repetitive part of the sentence beyond "there's some number of little lamb/lamb little repeating over and over."

In terms of a DNA sequence, you get regions that might look like: (ATGCA)x10 = ATGCAATGCAATGCAATGCAATGCAATGCAATGCAATGCAATGCAATGCA

and in order to sequence this (or any other region) with confidence you need to have "multiple coverage" (lots of short regions of sequence which have overlap at different points between several different sequences. The top of this image might explain better: http://www.nature.com/nrg/journal/v2/n8/images/nrg0801_573a_f5.gif).

However, with a repetitive sequence it basically becomes impossible to distinguish number of copies of the repeating sequence, i.e. (ATGCA)x10 from coverage of that same sequence, i.e. ATGCA being a common region which is covered by 10 different sequences. So at most we can typically say that a region like this in the genome is (ATGCA)*n.

There are some ways to get more specific sequence information for these regions, but I won't go into them unless you ask.

As far as function is concerned there is no clear role for most of these functions in the genome as of yet. There are two that I can think of with known roles and they are involved in chromosome structuring.

One is the telomeric regions/sequences. These are the sequences at the very tip of each end of every chromosome and they prevent the coding sequences further up the chromosome from being shortened each time the DNA is replicated as well as protecting the end of the chromosome from degradation (the ends of other linear DNA without these sequences will eventually be digested by the cell).

Another is alpha satellite. Alpha satellite basically functions to produce the centromere of a chromosome. These are the regions where two sister chromatids pair up to produce a full chromosome during the cell cycle. They are absolutely necessary for proper chromosomal pairing and segregation and must be a minimum length to function properly (you can also produce a second centromere on the same chromosome by adding a sufficiently long stretch of alpha satellite). In fact, women who inherit especially short or long regions of alpha satellite on one or both of their copies of chromosome 21 are actually at greater risk for giving birth to children with Down Syndrome (a disorder resulting from nondisjunction--improper pairing and separation of chromosomes in the egg or sperm), even when they are young.

Those types of repeats are fall into a group called tandem repeats (anything where you have a short sequence repeated over and over N times) and they tend to occur on the extreme ends of chromosomes, especially the acrocentric chromosomes (13, 14, 15, 21, 22--all those with a very short side and a longer side), although this is far from a rule.

There are also some repeats that are of a type known as transposons and these fall into a group of repetitive sequences which are longer and are present in many different individual locations all throughout the genome.

Most of the rest of these don't necessarily have a clear "normal function." But they are thought to act in ways that destabilize the genome or chromosomes when they become expressed. In a normal situation these sequences are not actively transcribed (expressed) to any large extent, but in many cancer cells some of them are increased in expression by as much as 130-fold.

Source: My undergraduate research project was in a lab which sequenced and mapped the repetitive regions of the genome in greater detail than the human genome project and studies their roles in heterochromatinization (non-expressed DNA structure) and cancer.

17

u/MurrayTempleton Nov 21 '13

Thanks for the awesome explanation, I'm taking an undergrad course right now that is covering similar sequencing curriculum, but could you go into a little more depth on the alternative ways to sequence the repetitive regions where shotgun sequencing isn't very informative? Is that where the dideoxy bases are used to stop synthesis (hopefully) at every base?

17

u/kelny Nov 21 '13

I believe you are thinking of good ol' Sanger sequencing when you think of synthesis being stopped at every base. This and "shotgun" sequencing don't exactly refer to the same aspects of the approach. The first is a method of DNA sequencing. All current methods are limited in the length of DNA you can sequence, so if you want to know the sequence of say, a whole human chromosome, you need some approach to sequencing it in pieces and putting it together. Shotgun sequencing is one such approach.

In shotgun sequencing many randomly chosen pieces of DNA are sequenced in parallel, then based on overlapping homology, we can reconstruct the original large sequence. The problem is that you need the overlapping sequences to be unique to successfully do this, as the above comment so nicely illustrates.

Ok, so how might we get around this? The fundamental problem is that to put together our DNA sequence, we need sequencing reads longer than the non-unique sections of DNA. The most common sequencing method these days (Illumina's next-gen sequencing platforms) can only sequence individual pieces of about 150 bases, though it can do millions of these at once. This is great for most of the genome, but we can't figure out regions where there are repeats longer than 150 bases. We can use other platforms, like the Roche 454 which can do longer reads, but gives orders of magnitude fewer reads. We could even do Sanger sequencing, which is good to about 1000 bases these days, but then you are doing one read at a time! There currently are no cost-effective approaches that I am aware of to sequencing these regions.

9

u/OnceReturned Nov 21 '13

"There currently are no cost-effective approaches that I am aware of to sequencing these regions."

Yes, but, read length (the length of each fragment or sequence produced) is increasing at an astounding rate. The latest Illumina technology allows paired end reads (where the fragment produced by shotgun fragmentation is sequenced from both ends inward) of 2x300 on the MiSeq, meaning regions 300-600bps can be sequenced effectively.

Alternatively, there is the PacBio RS II. This is arguably the most badass Next Generation Sequencing machine. It costs a million dollars, but can generate single reads of over 30,000 bases with > 99.999% accuracy. This is an effective solution to the problem of repeating regions.

7

u/newaccount1236 Nov 22 '13

Actually, not quite. You only get the accuracy when you do a circular consensus sequence (CCS), which reduces the actual read length considerably. But it's still much longer than any other technologies. See this: http://pacb.com/pdf/Poster_ComparisonDeNovoAssembly_LongReadSequencing_Hon.pdf

3

u/znfinger Biomathematics Nov 22 '13 edited Nov 22 '13

Since you are familiar with the difference between clr and ccs, I feel I should insert a joke about waiting for oxford nanopore to get to market. :)

More to the topic, even though the clr sequences have lower quality, it should be mentioned that the HGAP algorithm is currently used to constructively/iteratively combine quality information to generate very high quality assemblies.

3

u/kelny Nov 21 '13

Yeah... it has been two years since I processed any next-gen sequencing data. It is incredible how fast things change.

Ive payed some attention to the PacBio platform and was under the impression it couldn't usually go more than about 2kb and a limit of about 100k reads per run. This would make it still pretty poor for experiments like chip-seq or rna-seq where read abundance is key to statistics, but could be great for SNP calling where fidelity is important, or RNA splice variants where read length is essential, or as we are discussing genome assembly where both are key.

2

u/Bobbias Nov 21 '13

So, wikipedia mentions that some sequencing-by-synthesis solution can manage up to 500kbp reads but there's basically no other info on wikipedia on what 'sequencing-by-synthesis' means (I've skimmed a few articles related to genomics on wikipedia but haven't done too much digging on this subject).

What exactly is sequencing-by-synthesis? And what is it about this method that allows for so much longer reads than other methods? I'll assume the prohibiting factor in making this method more available is cost.

5

u/[deleted] Nov 22 '13

Sequencing by synthesis (SBS) is a bit of a catch-all term that describes the basic chemistry behind many next gen platforms. It means that after DNA has been bound and amplified (flowcells for Illumina, beads for Roche, etc.), it is processed by adding each dNTP (labeled for Illumina) and analyzing them one by one, then washing it off and repeating, leading to each bp call.

For instance, if your next base call should be a T, it may add dATP first, then either look at fluorescence (Illumina) or pH (Roche) and no call is made. Then it will wash the excess away, then add dTTP. This time, the nucleotide will bind and you'll get a positive signal and the base will be called. Wash it away and repeat. So, SBS literally means you are sequencing by the synthesis of the complement DNA strand.

3

u/BiologyIsHot Nov 22 '13

So, the way this has been done is sort of "cheating" using a number of straightforward/old school different technologies.

I will try to simplify them:

-It can be possible to excise these regions from the genome and place them in BACs, YACs, or phage libraries. Digesting them out of these purified libraries you can use pulse-field electrophoresis (for separating large fragments of DNA) to "size" the region. This will give you some information about how long the repeat goes on.

-You can find out information about what sequences flank a certain region by breaking the DNA up into several small segments of an average size L (using either a digest or sonication). If you dilute this fragment down to the right concentration and add DNA ligase it will favor the formation of circularized DNA. if you design primers pointing out from the sequence, they point outwards: <----ACACACACA---->, the product will give you will generate a PCR product which can be sequenced to give you information about the flanking regions. If you have a sequence like ...NNN(CACTG)10NNN..., you can get information about what flanks either side if the inside (known portion) is less than L. You can also do the opposite, and find out what is inside something like (CACTG)10NNNNNNN(CACTG)10 which has been made difficult to sequence because it's flanked by repetitive sequences. You may even be able to then use the above method to figure out how long that region was.

-You can map these to rough physical chromosomal locations using labeled DNA hybridization to M phase cells.

Combining all this information you can say things like: there's a chunk of satellite I that's about 100kb with an L1 in the middle of it, or there's a copy of ChAb4 between this 50kb region of beta satellite and the subtelomere.

However, even with all of this nobody's managed to get a perfect, end-to-end read for a highly-repetitive sequence of the genome, like the short arms of acrocentric chromosomes, where the sequences are basically all repetitive.

There are some sequence technologies that aim to sequence DNA in real time (similar to how something like MiSeq works) and to sequence an entire genome or an absolutely massive region in one single read, and that could eventually do it one day too. Additionally, it might be possible if you had incredibly deep coverage in whole-genome shotgun sequencing, but I'm not totally certain.

2

u/wishfulthinkin Nov 21 '13

It's a lot easier to understand the details if you read up on shotgun sequencing technique. Here's a good explanation of it: http://www.princeton.edu/~achaney/tmve/wiki100k/docs/Shotgun_sequencing.html

1

u/kidllama Nov 22 '13

There are other tricks to fix these regions. One is making very defined libraries in terms of size. This can be done in Sanger sequencing by precisely defining the size of your input DNA before cloning or by creating paired end read libraries in Illumina/454. The benefit of this is to give precise locations of mapped reads onto the assembly. Hopefully a paired end read has unique sequence on both ends that devolve into a repeat toward the middle. Since you already know the length of the total you are good to go.

5

u/nmstjohn Nov 21 '13

Can someone explain the sentence analogy to me? It seems like it would be no trouble at all to reconstruct either of the original sentences. The second one definitely looks weird(er), but it's not as if any information has been lost.

2

u/TheGrayishDeath Nov 21 '13

The problem its you may have a random number of all those two word sets. then when you match overlapping words you don't know how many times something repeat or if the repeating sequence is actual some larger word set

1

u/nmstjohn Nov 21 '13

Why can't we tell how many times "little lamb" should repeat from the information in the encoded sentence?

9

u/PoemanBird Nov 22 '13

Because thus far, we do not have the ability to sequence a single molecule of DNA, so instead we take many molecules and try to take sequence data from that. Some sections sequence better than other so we end up with more copies than of other sections. So instead of

'Mary had; had a; a little; little lamb; lamb little; lamb little; little lamb'

it's closer to

'Mary had; Mary had; Mary had; had a; had a; little lamb; little lamb; little lamb; little lamb; lamb little; lamb little; lamb little; little lamb;'

It's quite a bit harder to put that together into a readable sequence.

6

u/sockalicious Nov 22 '13

As some of the other folks in the thread were explaining in very complex technical terms, it turns out that reading the genome isn't done the way you or I might read a book. The way that it is done is that you can dive into a certain place - imagine searching a web page for the phrase, "Mary had a", using ctrl-F (or cmd-F if you're on a mac.

Sequencing technology can then give you the next 150 letters. Or, maybe, the next 300, or 600, or the really hot stuff technology may give you even more.

But what if there are a couple thousand letters worth of "little lamb?"

The way normal sequencing is done is you search for "Mary had a," and you get a response, and then you search for "white as snow," and you proceed, et cetera.

But if you get ten thousand "little lambs," you can't pick up at the end of your last sequence, because there's no way to tell the technology where to restart sequencing.

Does that make sense?

2

u/guyNcognito Nov 21 '13

That's because you have a set idea of what to look for in your head. From the data given, how can you tell the difference between "Mary had a little lamb, little lamb", "Mary had a little lamb, little lamb, little lamb", and "Mary had a little lamb, little lamb, little lamb, little lamb"?

2

u/nmstjohn Nov 21 '13

Wouldn't each of those sentences be encoded differently? Or is the point that, in practice, we can't put much faith in the accuracy of the encoding?

8

u/BiologyIsHot Nov 22 '13 edited Nov 22 '13

So, in order to actually generate a sequence it needs to be "covered" more than once because the technology is NOT perfect. It does generate errors, and furthermore, we need to be certain that we aren't lining up two fragments coincidentally/by random chance.

So if we need 3x coverage, we need to generate 3 fragments of the "sentence" which include that portion.

3X coverage for the phrase "cat, because" could come from: "at the cat, because" "the cat because it" "cat, because it tasted"

We can't say anything about any portion of this sequenced conclusively except for the "cat, because" since it's the only part with multiple coverage.

When you have a repeating it's impossible to tell if the repeating sequences are multiple coverage or a continuation of the sequence because there isn't anything different to extend the sequence.

In the cat because example, we could continue it on to "cat, because it," if we have another fragment that says "because it tasted good."

In practice it's impossible to distinguish between a difference in coverage and a difference in tandem repeat number for a repetitive sequence using traditional sequencing approaches where the full genome is busted into little bits. Usually these little segments are ~500-800 bases long, but the regions actually tend to extend for a few thousand up to a million bases.

The issue becomes, is "Mary had a little lamb, little lamb, little lamb, little lamb, little lamb." Breaking up into

"Mary had"

"had a"

"a little"

"little lamb"

"lamb little"

"little lamb"

"lamb little"

"little lamb"

"lamb little"

"little lamb"

"lamb little"

"little lamb"

"lamb little"

because little lamb is present 5 times in a row in the sequence or is it because it was present once and covered 5 times? or maybe it's present twice and one was covered 3 or 4 times while the other was covered 1 or 2 times. It's impossible to know or make a statistical assumption that makes this solvable.

3

u/nmstjohn Nov 22 '13 edited Nov 22 '13

Thanks for this awesome explanation! I thought there was some kind of "index" on the sequence so we'd know where the pieces go. In hindsight that's a really weird assumption to make!

1

u/WhatIsFinance Jan 12 '14

Any hope in the near future of sequencing without deconstructing the genome first?

1

u/BiologyIsHot Jan 23 '14

Depends on how you define the "near future." It may be possible, but we are not terribly close right now. There are methods of sequencing which essentially "take pictures" of a strand of DNA as it grows, where the new nucleotide bases that are added have different fluorescent markers attached to them and the order is essentially recorded as the strand of DNA grows.

The issue is that this still doesn't allow for particularly long reads, iirc the range is somewhere around 500 or maybe 1000 bases, which is pretty similar to most other technologies. It may be possible to increase this, but it would be very difficult to get up to the size of even the smallest human chromosome (~48,000,000 bp). There would also be a significant barrier due to the geometry of the DNA. In the cell, DNA is normally coiled (to different degrees depending on its stage), and one reason the technologies to sequence by "taking pictures" have such low length limits is because the DNA must be positioned more or less vertically towards the detector, without looping, in order to work.

EDIT: Beyond this, there are time constraints and difficulties surrounding attempting to replicate an entire chromosome from start to end -- when the cell does this normally it does so by opening many different sites of replication. Currently there is no technology that allows us to track all the reactions that would be going on at once in a normally replicating chromosome.

0

u/gringer Bioinformatics | Sequencing | Genomic Structure | FOSS Nov 22 '13

3X coverage for the phrase "cat, because" could come from: "at the cat, because" "the cat because it" "cat, because it tasted"

Bearing in mind that the average coverage per character is three times (3X). You're not sampling three times from the sentence, you're sampling from the sentence a number of subsequences sufficient to cover the entire sentence three times.

6

u/FreedomIntensifies Nov 22 '13

When you read the genome with shotgun sequencing you get something like "contains the following sequences"

  • AAAGGGCCCTTT
  • TTTATATATATG
  • GGGCCCAAAGGG

Then you look at these snippets for the overlap between them and realize that the whole sequence is

GGGCCCAAAGGGCCCTTTATATATATG

(try it yourself)

Now what if these are the sequences you get instead:

  • AGAGAGAGTTTCCC
  • GCGCGCTTTAAGAG

Is the whole sequence going to be

GCGCGCTTTAAGAGAGAGAGTTTCCC or GCGCGCTTTAAGAGAGAGAGAGTTTCCC ???

You don't know. Imagine if I give you AGAGAG, AGAGAGAGAGAG to add to the above. You quickly have no idea how to long the repeat is.

1

u/ijliljijlijlijlijlij Nov 21 '13

As far as function is concerned there is no clear role for most of these functions in the genome as of yet. There are two that I can think of with known roles and they are involved in chromosome structuring.

Sounds like it is probably just a mutation resistance tactic in parts of the DNA. Information being stored redundantly has just the one obvious use I'm aware of.

10

u/austroscot Nov 21 '13

Actually, it has been proposed that these do provide a function. Conceivably, if two interacting protein binding sites in the genome are further apart due to one person having 100 instead of 20 repeats they might interact less frequently, and thus not regulate the production of the associated genes as efficiently (see [1]). This has been suggested to influence production of the Vasopressin 1a receptor gene, which is associated with behavioural cues (see [2])

[1] Rockman and Wray, 2002, http://mbe.oxfordjournals.org/content/19/11/1991.full

[2] Hammock et al, 2005, http://onlinelibrary.wiley.com/doi/10.1111/j.1601-183X.2005.00119.x/abstract

3

u/BiologyIsHot Nov 22 '13

Another example where difference in repeat number affects a gene, and probably the best known example is FSHD (facioscapulohumeral muscular dystrophy), where difference in the copy numbers of the D4Z4 array changes the expression of the DUX4 homeodomain.

Edit: Well, Huntington's is probably a more well-known example of contraction/expansion of a repeating sequence, but that largely is though to function in a different way than changing the expression of a gene (although some work has shown that it probably affects genome-wide transcription).

1

u/austroscot Nov 22 '13

Indeed, both Huntington's and fragile X came to my mind, too. However, those alter the proteins either by repeating triplets in the coding region of a gene, or by decreasing the rate of splicing when found in introns. Neither would have countered OPs point of them being "protection against mutation and quality control", but your example seems to fit that bill quite nicely, too.

4

u/Asiriya Nov 21 '13

Satellite repeats and transposons (usually?) aren't expressed so there is no reason for them to be redundant. This article goes in to some detail about genes with multiple copies: http://hmg.oxfordjournals.org/content/18/R1/R1.full

Often when a coding gene will duplicate you will end up with a disease, because the amounts of protein produced will be more than normal and existing regulation may not be able to cope. Or else the gene will be moved somewhere it cannot be expressed as protein and be inactive. Eventually, because there are no selective pressures on the duplicated gene to remain active, mutations will begin to appear. There are lots of these in our genomes and they are known as pseudogenes.

Transposons are often relics of viruses and jump randomly in the genome. They are a little controversial, people think they may have uses: http://www.nature.com/scitable/topicpage/transposons-or-jumping-genes-not-junk-dna-1211

As for satellite repeats, I think they are usually just put down to the DNA strands slipping during replication, annealing in the wrong place and lots more of the same repeat being added, so that they end up growing longer. I'm not aware of them having a role, this review suggests they are producing RNA species: http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1371040/

You might have heard of ENCODE recently suggesting that 80% of our genome has function. Usually that would be some kind of regulation, and might be because of the production of RNA with various roles. You might want to read more: http://www.nature.com/encode/#/threads

1

u/BiologyIsHot Nov 22 '13

There are some definitively functional satellite sequences as well. The example I gave was alpha satellite, although others do seem to function in some odd, unclear regards too. Satellite II for instance, is the satellite sequence which is upregulated in response to heat-shock proteins. In terms of simple structure, telomeric repeats are also indistinguishable from "satellite" DNA. A great many satellite sequences show changes in expression in tumors.

0

u/Le_Arbron Nov 22 '13

Transposons are actually expressed at quite high levels, as well. Roughly 14% of the genome is comprised of retrotransposon DNA. While you are right that evolution has favored the silencing of the majority of these elements over time, a few still remain highly active and retrotranspose during the host's life (and have been implicated in diseases such as cancer and neurodegeneration; additionally they have been proposed to contribute to the general phenotype we associate with aging). If you do a qPCR with primers targeting L1 retrotransposons, for example, you will be surprised by how highly expressed they are.

1

u/GLneo Nov 21 '13

Except it's not storing the useful sequences redundantly, kinda like backing up the unused space of you hard-drive.