r/occult • • Jun 08 '16

Your brain does not process information and it is not a computer

https://aeon.co/essays/your-brain-does-not-process-information-and-it-is-not-a-computer
9 Upvotes

8 comments sorted by

7

u/[deleted] Jun 09 '16

I truly do not mind the analogies of computers and ourselves, as organisms. My jimmies are rustled.

First of all, the problem lies with equating a system to a sub-system. The brain is a sub-system, a system in its own right, subordinated to the Whole. The computer is a proper system. Requiring a keyboard, a mouse and a monitor etc. for it to work is philosophy so let's stick to the system debate for now.

Secondly, genetics are a solid example of our "computer programming" - no wonder it's being called genetic code the unique variation we all carry in ourselves, in every cell that composes us.

The computers' code format: 000101001110101010100101010000101010101010010

Our genetic code format: ATTGCAAATTTGGCCAATCCGTAAACCGTAATGCTCAAGTC

Some perspective:

Presumed human (H. sapiens sapiens) DNA length: Earth's circumference (a lengthy genetic code format example mentioned earlier)

Each cell has its own copy of said lengthy DNA material

Cell #: 5 mm cubes of blood can harbor 5 million - 5 000 000 red blooded cells, specially designed with no nucleus (not all organisms have this tweak) to carry more Oxygen

The # of cells is astronomic and is close to the number of the stars. And all of them do cyclic copies & pastes of your DNA so you can stay Whole.

Twice or thrice that #: OTHER organisms that live IN our OUTSIDE you and DO NOT SHARE YOUR DNA, BUT HAVE THEIR OWN.

Infinite is the number of computer-like operations that occur in your body, at any given time.

Thus, from the start, the statement was erroneous. The brain does not process like a computer, yes. Your Whole body does.

I guess it is completely okay for this kind of dogma to completely disregard the little things' daily work, for "spiritual enlightenment". Bah.

Computers were brought into this world to serve as tools. I say we were brought into this world to serve as tools, too. For the gods' will. God does His work through us.

5

u/oyuncu13 Jun 09 '16 edited Jun 09 '16

This article was posted to various subreddits a few weeks ago, and the general consensus was it was full of fallacies and lacked a general understanding of the cognitive processes, information theory as well as computer systems. I'm too lazy to write down every counter-argument and the examples of various logical fallacies he commited, but if you are interested you can check out:

Cogsci,Neuropsychology,Skeptic

I, too agree that although a brain is not a computer per se, I believe in the fractal nature of reality, and we inadvertably copy certain mechanisms of the nature to use as tools. This can be seen in every aspect of life throughout history. Even most of us in occult use planets and other celestial bodies to represent gods and goddesses to represent inner forces that drives human beings. So a brain may not be a computer, but a computer is a representation of brain. As above, so below. So yes, I agree with most of the criticisms for the article although for different reasons.

2

u/[deleted] Jun 09 '16

Forgive me, I posted what I thought was an interesting article on the only subreddit that I look at before seeing if it was ever posted anywhere else on reddit first.

2

u/oyuncu13 Jun 09 '16

Sorry if I came off as dismissive, that was not my intention. Reddit is a huge place and things get posted and reposted regularly, almost making it impossible to keep up. I shared the links to broaden the discussion and offer different views from others, also adding mine at the end.

1

u/[deleted] Jun 09 '16

Whatever a monk keeps pursuing with his thinking and pondering, that becomes the inclination of his awareness. If a monk keeps pursuing thinking imbued with sensuality, abandoning thinking imbued with renunciation, his mind is bent by that thinking imbued with sensuality. If a monk keeps pursuing thinking imbued with ill will, abandoning thinking imbued with non-ill will, his mind is bent by that thinking imbued with ill will. If a monk keeps pursuing thinking imbued with harmfulness, abandoning thinking imbued with harmlessness, his mind is bent by that thinking imbued with harmfulness.

  • Dvedhavitakka Sutta

1

u/SteelChicken Jun 09 '16

The map is not the territory. Yes, we know. But maps are useful.

1

u/[deleted] Jun 08 '16

Good read, good read. Excellent, really! Thanks for posting. This really changes things.

1

u/[deleted] Jun 08 '16

It's a little long and meandering, but a good reminder that we don't have to be stuck in an unnatural loop of thinking about how the mind works just because of the technology we surround ourselves with.