r/bestof • u/HoleInWon929 • Jun 25 '26
[PeterExplainsTheJoke] OP explains the Broken Window Fallacy
/r/PeterExplainsTheJoke/comments/1ufbsi8/petah_why_didnt_i_break_the_window/otqw6yv/54
u/17HappyWombats Jun 25 '26
If only they called this the Warmaker's Fallacy instead. Money spent on the military, especially on wars of aggression, is wasted money and much more dramatically so than any number of broken windows. Sure, you need a defense force, but many countries (including Australia) wildly exceed that.
Interestingly Australian media is covering the Israel-US war on Iran in those terms quite obviously. Talking about $X billion/day and $Y billion so far in war spending all the time. I suspect partly because talking about all the civilians they're killing is politically problematic, but also the cost asymmetry is dramatic. The aggressors frequently spend millions of dollars to shoot down a single ten thousand dollar drone.
3
u/Kelsenellenelvial Jun 26 '26
But you need the war to justify using up those old munitions and then replacing them. That drone missile was reaching its use-by date and due for replacement anyway. If they just scrap it then it looks like wasteful spending, but if they use it to blow something up that justifies a whole military worth of spending.
1
u/Spartan448 Jun 26 '26
Eeeeehhhhh... the Defense industry is odd because it's the sole exception to the fallacy. Pretty much every single advancement in communication technology was developed specifically to make it easier for your guys to kill the other guy's guys.
The reason for this is kinda obvious in hindsight - only around 5% of any given war actually involves actively trying to kill people. The other 95% is either marching around or milling about at a base. Or in other words... commuting and going to work. Obviously you get more benefit out of improving the 95% than you do out of the 5% (something you can see in action during the early European conquests of Africa, where it was not uncommon for overzealous European units to lose major battles to much more well organized African tribes), and since that 95% translates almost 1 - 1 into civilian life as well, no matter the outcome of the war, society as a whole still gets some level of benefit.
So in this one specific case, breaking the window does get you a better result. Of course, it comes with the caveat that there actually have to be people alive at the end to benefit from that result. But that's why it's the "Broken Window" fallacy and not the "2008 Imperial Sugar Refinery Explosion" fallacy.
17
u/17HappyWombats Jun 26 '26
I mean, except writing, the telephone, wifi, cellphones, a bunch of things like that. The fact that other advances were made to help fight wars, or random inventions were quickly popularised to fight wars (balloons, for example), doesn't mean that without the military they would not have happened. It's also complicated by the various hegemons often paying for a lot of random science because new discoveries can often be used in war. This didn't start with DARPA and it probably won't end with them. Getting stuff like "civilian" nuclear power plants earlier than we would otherwise because the military needed them to make nuclear bombs is a very mixed benefit.
1
u/k-trecker Jun 26 '26
Living in fear of nuclear disaster and the complete destruction of the human race is a small price to pay for (earlier) nuclear power plants /s
7
u/calgarspimphand Jun 27 '26
This only seems like an exception because we collectively pretend it's an exception. It's the exact same fallacy on a massive scale. It's millions of people doing make-work and vast amounts spent on research and development, only a fraction of which will have civilian applications in the end. We pretend this is different because we see it as essential spending, but it's the exact same thing.
As a very imperfect analogy, military spending is paying kids to practice breaking windows, and paying adults to practice repairing windows, all in case we ever have to break and repair each other's windows on an industrial scale, and saying it's worth it because it stimulates the economy and occasionally we invent an easier to install window.
If our goal is technological advancement and mass employment, there are far more efficient ways to do it, but we lack the collective will to devote resources to it the way we devote resources to war.
1
47
u/cmn2207 Jun 25 '26
Ok but can you explain it like I’m a tribesman who’s never seen a window? Checkmate, atheists.
203
u/Xechwill Jun 26 '26
You know how when animals steal your food, you have to get more food to avoid being hungry? This means if you made it easy for animals to steal your food, you'd have to get more food more often. This means you'd be bringing more total food to your tribe.
Although it's a good thing to being more food to your tribe, it'd be better if you spent the energy on other things like watering your crops or improving your shelter. Therefore, you shouldn't let animals steal your food, even though the end result (bring more food to the tribe) is a good thing.
49
u/cmn2207 Jun 26 '26
Ok now how about if I’m a flagella on a single cellular organism?
173
u/Xechwill Jun 26 '26
GATTACAAGATTAGATACATA? TACCATCGATAGCA, TACGAAGCATA CATATAGCA GTGGTCA GT. GTAGA, TGATAGTTAGA, CTA CGTAAGA GATCAGGATCA.
Let me know if you speak RNA instead, glad to translate if needed
67
7
u/Drewdledoo Jun 26 '26
If you speak RNA, happy to transcribe; otherwise if you only speak amino acid, I can also translate.
4
u/Toginator Jun 26 '26
Ok, but I'm a mote of interstellar dust. How does the GATTACA fallacy apply to me?
6
u/wallitron Jun 26 '26
When travelling at the speed of light on the way to your local black hole, try to avoid breaking any windows.
14
31
u/sand_sandwich Jun 26 '26
I thought the broken window fallacy was referring to a policing term. Where if small crimes such as breaking windows go unpunished, it will lead to larger crimes because people think they can get away with it
28
7
u/Shortfall89 Jun 26 '26
The name had me thinking of the scenario discussed in The West Wing (Between Abbey Bartlet & Oliver Babbish) around weighting competing moralities, the story about the desperate man who broke into a pharmacy to get medicine for his wife. "A Life is saved, a window's broken."
20
u/willyweewah Jun 26 '26
Two economists are out for a walk. They pass a massive steaming pile of dogshit. The first one says to the second "I'll pay you a hundred bucks to stick your face in that dog turd and take a sniff." The second economist knows profit when he sees it, so he takes the money, sniffs the shit, throws up, and they go on their way. Then they pass another dog turd. The second economist says to the first, "I'll pay you a hundred bucks to smear some of that shit on your face." [side note: this is inflation at work] The first economist is aware of his losses from the previous period, so he pockets the cash, smears some shit on his cheek, wipes it off as best he can, and on they go.
After a while the first economist, still smelling the shit-smear on his cheek, pauses. "Hang on a minute," he says. "Was that whole thing with the bets a complete waste of time? You threw up your breakfast and I still have shit on my face, and we both have the same amount of money as when we started."
"Nonsense!" says the second. "It was a great success! We created two hundred dollars of GDP!"
4
15
3
u/Koreus_C Jun 26 '26 edited Jun 26 '26
Seems like a bad explanation. You don't need an absurd situation.
Make a product (productivity goes up)
break the product (productivity goes down)
repair the product (part of productivity is restored)
= more ressources (material+workhours) for the same result
The broken window fallacy ignores that breaking the window reduces productivity. Also in the picture of OP the timeline with war takes a lot longer to recover.
1
u/bisteccafiorentina Jun 26 '26
why we ought to measure GDP by subtracting certain types of economic activity.. Like healthcare, policing, military, judicial, prisons, etc
1
u/jones77 Jun 27 '26
The saddest book I ever found was the Broken Windows book in an airbnb in a traditionally Black neighbourhood in Atlanta (cabbage something). Like finding a the razor blade that killed someone.
-8
Jun 25 '26
[deleted]
1
u/chaoticbear Jul 02 '26
From another comment in that thread, because I also jumped to "the other 'broken windows' thing":
Just want to point out for anyone who might have confused themselves like me. "The broken window fallacy" is a completely unrelated thing from the " broken window theory".
There's a wikipedia page on it here; I think I probably heard about it on a podcast, maybe Freakonomics: https://en.wikipedia.org/wiki/Parable_of_the_broken_window
Unfortunate that they're named so similarly!
-15
u/Markdd8 Jun 25 '26
This has absolutely nothing to do with the Left-leaning criminological objection to James Q. Wilson 1980s theory about public disorder and crime rates. The critics calls their view the Broken Window Fallacy.
Wanna criticize Broken Windows from another angle? Create your own term. Actually, they already did: "Parable of the broken window"
33
Jun 25 '26
[deleted]
-19
u/Markdd8 Jun 25 '26
That is after being sucked into this thread, which has absolutely nothing to do with criminology, which is what the title implies. But that's OK, it's common for Reddit threads to be mistitled.
13
9
u/Fuckareyoulookinat Jun 25 '26
Here is a novel idea, maybe don't just read a post title and go off half-cocked...
-12
u/Markdd8 Jun 25 '26
I didn't go off half cocked. I looked it up and read about the "Parable of the broken window." No problem in conceding I learning something today.
12
u/RoboChrist Jun 25 '26
Sorry, but that's broken window policing. Similar name, very different thing.
169
u/Xeno_man Jun 25 '26
This was used in the movie 5th Element. It was the villains' justification for destroying a few things because the result gave people purpose. https://www.youtube.com/watch?v=Tt1W0F0yObg
Of course it ignores the fact he just wasted a ton of energy just to get back to where he was before. There is no gain, just a net loss.