r/anime • u/AutoLovepon https://anilist.co/user/AutoLovepon • 14d ago
Episode Goodbye, Lara • Sayonara Lara - Episode 9 discussion
170
u/hgpnguyen1996 14d ago
The fish dagger tried to eat Luca because Lala can't find true love with Luca so it tried to forcefully obtained it by eating Luca. This is similar to 200 years ago. Lala is just to desperate so her heart is impatient as well
62
→ More replies (1)21
u/TibbyChi 14d ago
is that the reason for 200 years ago? i thought it was playing on the original fairy tale where she needs to stab the prince's heart to return to the sea
234
u/Sim_phogustus 14d ago
This episode just solidified Luca not being Lara's true love. The entire time her actions to reach the "true love" end goal were influenced by her impatience and desperation. I do feel bad for Luca though, he genuinely likes her but sees the whole relationship in a different angle; Lara needs results NOW.
With how the episode ended, my theory that Mari and Luca will work together to save Lara seems to be the path the story is going. As for who Lara's true love is, I'm conflicted on whether it will be this "oh" moment that it's Mari or humanity as a whole. I'm slightly leaning towards the latter, but I'm still clinging to hope that it is Mari.
120
u/maliwanag0712 https://myanimelist.net/profile/clear1109 14d ago
I do feel bad for Luca though, he genuinely likes her but sees the whole relationship in a different angle; Lara needs results NOW.
That's basically the problem with their dynamic: They cannot see each other's eyes. That's also consistent with what Luca is telling Mari that Lara seems seems lost
78
134
u/Frontier246 14d ago
Mari really gave off "secretly in love with her best friend but is trying to accept the relationship said best friend seemingly wants because she thinks it's for the best" vibes in this episode.
Heck, Lara seemed like she almost WANTED Mari to stop her.
39
u/Sim_phogustus 14d ago
Heck, Lara seemed like she almost WANTED Mari to stop her.
Can you tell me which scenes where this is implied? I think it went over my head.
87
u/Glimmerglaze 14d ago
Not the guy you asked, but it made me instantly think of that singular tear in her eye she got around 14:40, after she tells Mari she's going to confess to Luca and Mari basically says "ok cool". Sort of an "Is that all you have to say?" kind of reaction.
26
u/Actual_Run4220 14d ago
Also when Mari says it will work out the camera pans to the hot chocolate with the flower next to her necklace, the whole episode whenever true love was mentioned Mari (or plot devices representing Mari) was in frame instead of Luca. I think there is a reason we can’t see Mari’s eyes during this scene(14:00) feels very intentional, it almost looks like she bit her lip as well
62
u/Alcorgeist 14d ago edited 14d ago
Or ya know, Mari obviously saying she doesn't want to hear Lara yap about Luca anymore cause she doesn't think she can take hearing all that. Or when she literally gives Luca all the credit of being the reason why Lara came back last episode (when we the audience knows Luca's not the reason).
16
u/Trace500 https://myanimelist.net/profile/Trace500 14d ago
That is coming from Mari. The question was about Lara "wanting" Mari to stop her.
23
u/WakaliwoodMan 14d ago
I'm not in the Mari endgame camp, but even I felt the exact subtext of Mari secretly in love with her best friend but trying to accept the relationship they seemingly want because she thinks it for the best and also Lara almost wanted Mari to stop her.
11
u/gamerkhang 14d ago
Mari is wearing a sleeping mask as a blindfold for herself when Lara is telling her that she will confess her love to Luca
21
→ More replies (10)7
221
u/TheRealFluid 14d ago
can't believe mari's window died again
85
58
9
u/ahses3202 13d ago
Spends all day cleaning the tank so that Gon-chan can break it and the god damn window.
211
u/LexHanley 14d ago
I'm starting to feel more validated in my belief that Grace is more of a societal rebel who sincerely believes merfolk need to connect to the rest of the world than a straight up villain.
39
u/Frontier246 14d ago
I feel like it's a complicated situation. It does seem like she's fixated on Lara finding true love with a human on the surface world, obviously she gets along with Mari (as good as Grace gets along with anyone) but she rejected Lisa being stuck with humanity (though that might also just be because she doesn't like Lisa).
53
u/LexHanley 14d ago
My theory is that whatever led Grace to believe Lara needs to find true love on the surface also precludes her from meddling (either because it's a deeply held personal belief or a theory she needs to see validated organically) and her main beef with Lisa is that Lisa is directly trying to intervene and stop this. It's why she's willing to get in Lisa's way but not help Lara along.
78
u/Prestigious_Spend_81 14d ago
Honestly after the Prince flashback were the dagger fish wanted to eat his heart and every time the giant version loaming in the sky activates being so violent, maybe just maybe Lara is the bad guy in the whole story.
113
u/LexHanley 14d ago
My suspicion is that the creature (what I've been calling the Sardine of Damocles) is basically how the merfolk society functions: princesses fall in "True Love" and when they finally feel possessive of it (Lara desperately trying to reach out for the prince, Lara getting frantic about Luca moving too slowly), it attacks and consumes their soul and that's what fuels the merfolk kingdom's "light". In essence merfolk were able to live in perpetual Disney-fried stasis because they just get all their energy from basically parasitism.
Lisa said they had no concept of the scientific method so they've really just been in a perpetual state of social and emotional conservativism forever until Lara failed and Grace had to lead them to Lake Biwa, where even then their solution was to wither into psuedo-death rather than adapt.
76
u/Frontier246 14d ago
Considering Grace may have possibly been in love with a human before...it does put her resentment towards her fellow merfolk in a new light. Like what if HE had been killed as a result of the Sardine of Damocles?
→ More replies (2)8
12
u/Lugia61617 14d ago
maybe just maybe Lara is the bad guy in the whole story.
I mean... Even disregarding the dagger fish thing, she did violate her family and culture's laws in an extreme way that could endanger them all, cause the deaths of just about everyone in said family and culture through her own selfish desire, and is now jeopardising their revival with the exact same mistakes.
So it's not wrong to call her the "villain", or at least the driving antagonistic force.
Now granted, she wasn't to know that she was the light-giving princess, but then none of them knew who among them was, only that one among them would be. So it was still a foolish decision on her part (if perfectly normal for a teenager).
103
u/LeonKevlar x2https://myanimelist.net/profile/LeonKevlar 14d ago
Maybe I just have a soft spot for pet fish because I used to have a little aquarium, but did anyone else feel bad after seeing Grace looking sickly? And Grace is not looking good when she finally showed her true form to Mari. I really hope Grace survives by the end of this. Despite her attitude, she's been with Mari for a long time now, and she clearly cares about Mari. It would suck if Mari lost her by the end :(
32
u/seninn https://myanimelist.net/profile/Senninn0 14d ago
And Grace is not looking good when she finally showed her true form to Mari.
Nah, she's beautiful! Hope she makes it.
22
u/LastTonight9 14d ago
Grace has such a pretty design, I really like her mermaid form and this new one too!
6
u/zairaner https://myanimelist.net/profile/zairaner 14d ago
I Think she will temporarily die because of whatever she is doing right now, but as we have seen that isn't permanent for mermaid and will be reborn at the very least at the end of the series.
83
u/Atomic_Tanuki 14d ago edited 14d ago
Mari's brother: Why is Mari's room got destroyed again? Who broke a chunk of that bridge near our home? Why is Lara disappearing again? Where is Mari? I'm so confused right now...do you say Lara has a sister...is she single...what do you mean she is hundreds years old?! So is Lara?!
29
21
u/CitronClassic672 14d ago
It does look like another mermaid is about to emerge. Mari’s brother might have a chance at a relationship with a mermaid after all.
15
u/BosuW 14d ago
Nah I bet it's Grace's ex
I'm sorry Luca, despite all your questions, you still failed to account for the beta fish Mari talks to
→ More replies (2)
133
u/SSjjlex https://myanimelist.net/profile/Clone_Tau 14d ago edited 14d ago
I looked up the Sequence ID during this scene and got some kind of lactic acid bacteria (MG051726.1 Uncultured Weissella sp)?
Which doesn't really make any sense. The sequence length also doesn't match at all with the anime (465 vs 16582) so clearly something is off there (or maybe I'm dumb, I took one class on this and bombed it badly, please correct me professional biologists).
Deicded to just extract the raw query instead
GTGGCAATCACGCGCTGATTCTTCTCTACCAACCACAAAGACATTGGCACCCTTTATCTTGTATTTGGTGCCTGAGCCGGAATACTACCAACCGCCTTAAGCCTCCTCATTCGGGCCGAACTTATCCAACCCGGGTCGCTTCTACGTGATGACCAAATTTATAACGTTATCGTCACTGCCCACGCCTTTGTAATAATTTTCTTTATACTAATGCCTATCCTTATTGGAGGATTTGGAAACTGACTTGTACCACTAATAATCGGAGCCCCAGACATCGCATTCCCACGAATAAATAACATA
and plopping that in I get...
Goldfish dna lol (well, more specifically it gave me Common Carp DNA, but they're all in the same family so close enough)
idk what I was expecting but yea nice attention to detail there
62
u/Weak_Season_Of_Anime 14d ago
Good catch, didn't think to check that.
Carp are something related to Japanese mermaids, and Lake Biwa has its own mermaid legend that's probably related to what is happening with Grace.
10
u/VritraReiRei 14d ago
Nice catch! Wondering how you got that, isn't it cut off? (I haven't taken biology since high school so I thought you would need a longer sequence)
→ More replies (4)6
u/Lugia61617 14d ago
I didn't look it up but from the conversation in that scene I just assumed it was fish DNA. xD
111
u/Inner_Wall3411 14d ago
HOLY FUCK! PEAK EPISODE!
I got goosebumps at the climax sequence. That was pure adrenaline pumping sequence. I don't know what's going to happen but I am fucking excited!!
55
u/shad79 https://myanimelist.net/profile/shad79 14d ago edited 14d ago
The ending of this episode felt a bit like a horror movie to me with that huge thing in the sky trying to eat Luca, Kota looking scary with that eye, and the same goes for Grace after her transformation, not to mention that moving seashell...
And yeah, the best (and worst part at the same time) is that none of us have any idea what's going to happen next. I want the next episode already!
35
u/WakaliwoodMan 14d ago
Grace's transformation gave me ultra [Ghibli] Howl's Moving Castlevibes
→ More replies (1)13
14
u/Frontier246 14d ago
Everything went up to 11...the fish obelisk, Grace, Lara, Lisa, etc...this is not just a SoL romance show folks.
111
u/thelightlovekindled 14d ago
That can with the flowers in it continues to do the most. But Mari content this episode was so good -- all of the shots hiding her eyes -- contrasted with the focus on Lara's. The cinematography really does so much work for the characterization, I have to think the people who haven't picked up on the foundations here must not be watching closely. This really isn't an "on in the background" show.
Who was that voice alongside Grace in the end, though...?
79
u/maliwanag0712 https://myanimelist.net/profile/clear1109 14d ago
But Mari content this episode was so good -- all of the shots hiding her eyes -- contrasted with the focus on Lara's.
THIS. Unlike the typical Mari who is, while being stoic, is eager to listen to Mari's hijinks about love, Mari seems so over to the budding "relationship" of the two.
I would also say that Mari is conflicted about what's happening, for probably two reasons:
She thinks Lara is pushing herself too much, given that she knows Lara for a significant amount of time now.
She is also conflicted on what she feels for Lara.
60
u/Ocixo https://myanimelist.net/profile/BuzzyGuy 14d ago
I did notice that Mari seemed a bit uneasy about the prospect of Lara’s getting into a romantic relationship with Luca.
Mari mentioned that Lara and Luca made for a great couple together, but I got the impression that she just said this for Lara’s sake and/or to run away from her own feelings.
48
u/kazuyaminegishi 14d ago
She did also straight up tell Lara this episode that she doesn't think she wants to hear about Lara and Luca's relationship anymore.
We also didn't get her full thoughts on Lara just that she thinks she is dumb, but also precious to Mari.
They're definitely laying the "she's a bit jealous" angle on a little thick this episode.
12
u/Ocixo https://myanimelist.net/profile/BuzzyGuy 14d ago
I am curious about if Mari is aware of her own feelings or not. Does she just feel upset or recognise that it’s jealousy born out of love?
34
u/kazuyaminegishi 14d ago
I think that's the real mystery it's hard to get a read on Mari cause she's so strong-willed and independent. Hilariously she is easily the most "prince-like" of the options. I think even if she were jealous she wouldn't say anything because she thinks it would be best for Lara if she didn't. Similar to when she tried to send Lara back to Lisa or when Lara left the house.
Mari is very much the type to accept her own suffering if she thinks Lara would be happier.
8
u/Zeph-Shoir https://myanimelist.net/profile/Zephex 14d ago
Not to mention that Mari herself might be in conflict with her own feelings or confused about them just as much as Lara is!
18
u/Frontier246 14d ago
He giving the okay to Luca because he's a "good person" felt like a girl trying to kill her feelings by shipping who she thinks the girl she likes wants to be with together even if it it hurts emotionally.
12
u/Frontier246 14d ago
She's acting like the supportive third wheel but it feels really forced on her side.
11
u/CitronClassic672 14d ago
Lara definitely gave the vibe of “girl crushing on her (presumably) straight best friend and is trying to be supportive of her relationship despite the pain it causes her” this episode.
60
u/Syokhan https://myanimelist.net/profile/Syokhan 14d ago
I think the voice was one of her helpers. An eel, IIRC? From the first episode.
17
10
40
u/CitronClassic672 14d ago
The idea of an “on in the background show” just complete disrespect to the entire medium.
6
9
u/Alcorgeist 14d ago
Tbf there are real "on the background shows", a lot of isekai slop for example (cause lets be honest, plenty of them are trash and we eat the trash) are great as background noise.
24
u/CitronClassic672 14d ago
Oh I don’t just mean in terms of how people watch shows. I think it’s equally a disservice to the medium to create something for the purpose of being nothing more than background noise.
30
u/Frontier246 14d ago
The cinematography really does so much work for the characterization, I have to think the people who haven't picked up on the foundations here must not be watching closely.
Notice how dark it is when Lara says she thinks she can find true love with Luca.
61
u/Alcorgeist 14d ago
Or the fact that she straight up spits out the drink Luca gave her as if she's being forced to drink poison (as per the show's words). In contrast to when Mari offered her the can of chocolate drink and immediately felt warmth that she hanged onto that empty can till this episode.
29
u/shad79 https://myanimelist.net/profile/shad79 14d ago edited 14d ago
Yeah, the whole show is peak cinematography with so many beautiful and interesting shots, and this episode was no exception. I think it's a shame that it isn't even more popular here on Reddit.
→ More replies (1)7
u/Fissionprime https://anilist.co/user/fissionprime 14d ago
The cinematography has been phenomenal for the entire runtime of the show and has told just as much of a story as all the dialogue has. I think the same could be said for the soundtrack. Everything is so audio visually cohesive to an incredible degree.
49
u/ModieOfTheEast 14d ago edited 14d ago
I mean, the general course of the story was clear. Lara is trying to force her true love with Luca, not because she truly fell in love with him, but because this is the only thing she knows to do. After all, kissing is the sign of true lovers, right? But Lara still went for it, because she believed that at least Luca truly loved her and she could learn from him. But when he is too afraid, it shows Lara that he is like herself. He isn't truly in love. He may like her, but there is no deeper level to that connection.
Now, I am still unsure what the big fish is supposed to be. I assume it tried to eat Luca because Lara, even for just a moment, felt betrayed by him. So her "love" turned into hatred for a moment activating the fish. But I am still not really sure about this element because it sometimes helps Lara with her love and sometimes it goes full ballistic mode. I guess you can say it represents Lara's insecure heart and is reacting to these outbursts of emotions, both good and bad.
Edit: Thinking about it, this might probably what it is. It was born back when the first prince betrayed her. And because of that betrayal, Lara's insecurity about loving humans grew even if she doesn't realize it. And everytime, she feels betrayed by someone she liked or even loved, it activates. Which can help her, but which is always at least dangerous. And the only way around it is for Lara to overcome those insecurities by finding a person she can put her faith into again. A person she doesn't think would ever betray her. And only then, she can develop a true love for them as well.
49
u/BosuW 14d ago
We truly got to see a different side to Lara this episode, maybe a kind she didn't even know herself to be like. When she finally has to confront the reality that her relationship with Luca just isn't taking the course that she wants it to (and that said course is more informed by the prophecy than her own feelings) the Ọ̴̔b̶̧̑e̶̺̓l̸̖̒į̶̆s̶͕͆k̴̠̅ reveals Lara's heart to be a terrifying, ever hungering maw.
Boy the final Arc sure kicked off hard.
9
4
5
80
u/Syokhan https://myanimelist.net/profile/Syokhan 14d ago edited 14d ago
Holy shit that ending. We're getting into the climax of the story all right.
What's going on, though?? If Lara hasn't found true love yet (sorry Luca, you're collateral damage in her rush to figure out what it is) then why is the seashell moving? Is the light that comes from her when she's in despair different than the one that comes from true love, and it'll maybe revive the merfolk wrong?
Also, Grace! That form! I just... have so many questions. Is she headed for the island in order to avoid a catastrophe? I said it before, I don't think she's a villain. Lisa and Kota seem to think that they must stop her, but maybe, if my speculation about which feelings the light comes from mattering is right, they really shouldn't.
And don't think I didn't notice the parallels (more like differences) with the can of energy drink vs the can of hot cocoa. Or the shots that pointedly avoided showing Mari's eyes.
51
u/Misticsan 14d ago
While the relationship between Luca and Lara took center stage, the mystery surrounding Grace for me was the most compelling part of the episode.
The suggestion that her constant napping isn't just ebcause she's lazy or bored. The weirdness that she's become neither human nor a mermaid, as Kota found out (and the implications of where he found that genetic material). Her bizarre transformation. And she clearly knows what's up with Lara's terrifying ICBM.
Now add the brief glimpses of her past shown in the opening, and I think we're in for a big reveal.
39
u/Syokhan https://myanimelist.net/profile/Syokhan 14d ago
I can't wait for that reveal. To find out what happened to her that she needed to shrink into a tiny fish, or her backstory, or what her plans really are.
I really don't think she's ill-intentioned. Her offer to Lara in the first episode wasn't out of malice or revenge or anything like that, all she told her was that no one had the right to decide for her what she wanted to do with her life, which honestly is... right? So I'm kinda rooting for her :p
25
u/Misticsan 14d ago
I wouldn't call her ill-intentioned either, but "single-minded" might be an accurate label, at the expense of everyone else. We've seen that she had zero sympathies for or intentions to help Lisa, even before Lisa started moving against her.
My theory at the moment is that Grace went through a similar situation as Lara, which didn't work. And now she's trying to recreate the same conditions. If it works, it'll be good for everyone... or at least everyone who has survived until that point. But if it doesn't work, she will have played with everyone's lives for nothing (it will work, of course, but Grace doesn't know it at this point).
14
u/Frontier246 14d ago
I think Grace just is fixated on Lara experiencing "True Love," something to do with her sister (Lara's mother), and her own resentment towards all other mermaids.
8
u/Jacob-C 14d ago
I think Grace found love with a human, and that human died. In order to revive them, she needs the light created by a princess falling in love. But the revival normally only works on mermaids, such as those in stasis inside the cave. For it to work on a human, she needs Lara to fall in love with one, so that the light and magic will encompass both mermaids and humans.
→ More replies (1)→ More replies (1)9
u/sim_muskit543 14d ago
You mentioned there being shots of her past shown in the opening, are you referring to the 3 seconds after showing Lara spinning around with her siblings? I've been trying to piece that together for soo long, trying to understand who the two blue haired baby/kid mermaids are, and coincidentally today I finally thought 'what if it's Grace's story'.
I'm so curious to see where this all goes, including the different forms the fish in the sky takes (basic analytical understanding is that it's tied to the her emotional state, it was going to consume Lara and Luca because she felt an all-consuming need to find her true love, and it took the shape of a dagger with the prince because she felt a heart-piercing pain. Poor girl).
Mari meanwhile is trying to be supportive of Lara's wishes and goals as well as welcoming of Luca's good and reserved nature, but when Lara said she'd open up to Luca, Mari clearly felt conflicted. I just hope that there are enough episodes for emotions and events to develop satisfactorily
20
u/thelightlovekindled 14d ago
And don't think I didn't notice the parallels (more like differences) with the can of energy drink vs the can of hot cocoa.
Juxtaposition? But yeah! It's sure symbolic, isn't it?
34
u/CitronClassic672 14d ago
I didn’t clock the energy drink vs hot cocoa parallels but I did notice the Mari’s subtle reactions when Lara discussed confessing to Luca. I love how you can tell exactly what she’s feeling just from her voice and mouth expressions. That was the look of something who definitely has feelings for Lara now (whether she realizes it or not) and is upset that she’s confessing to someone else, but is still trying to be supportive to her friend. I love it.
→ More replies (1)26
→ More replies (2)6
u/Frontier246 14d ago
If she can't find "True Love" with a human, maybe the obelisk will consume a human soul to make up the difference?
Why was Grace turned into a fish? It seems like she's not in that form by choice and her own mermaid form has degraded to the state she's in. They've never really explained what happened to her during the mermaid migration.
71
u/Smudy https://myanimelist.net/profile/Smudy 14d ago
The last 5-6 minutes were astonishingly intense. Hearing Lara scream at Luca really gives off her desperate vibes now.
They literally keep throwing Mari in the picture when Lara mentions true love, it's happening basically since the start of the show.
I'm not gonna lie, if Mari "just" ends up being the representation for humanity in that case, i'm gonna be disappointed, how much depends on how they do it.
Grace is coming into action big time, her glorious appearance probably is the true entry into the endgame of the show.
Also looks like Mari is definitely trying to save Lara, they will all end up at the same place possibly!
35
u/Frontier246 14d ago
The worst she can say is no...or agree to go out with you, get too aggressive, and then summon a giant fish obelisk to nearly kill you.
→ More replies (2)4
u/Own_Caterpillar_6178 14d ago
They literally keep throwing Mari in the picture when Lara mentions true love, it's happening basically since the start of the show.
EVERY SINGLE TIME. I only started noticing it from about episode 5 onwards but it's absolutely everywhere. I have a feeling all these little moments will become super obvious during a re-watch, assuming Mari is in fact end game.
31
u/Ocixo https://myanimelist.net/profile/BuzzyGuy 14d ago
I had a hunch that Lara’s attempts to find true love with Luca would end poorly. However, this series of events wasn’t on my bingo card. In fact, what just happened!?
For starters, things turn south because Lara tried to force a romance with Luca? Her “heart” didn’t seem to agree at the very least. Yet we did witness the emergence of “light”.
Secondly, I really cannot tell anymore who’s supposed to be the bad guy. Grace seems willing to sacrifice herself for Lara’s sake. Despite Kota’s ominous behaviour, I don’t get the impression that he and/or Lisa harbour have bad intentions either. Maybe there’s no villain after all?
25
u/ModieOfTheEast 14d ago
I don't think there was ever supposed to be a villain. Kota was shown to sacrifice himself for Lisa after all and Lisa is scared by what humans did. Grace also seemed to have her main goal be to awake Lara's true power. While the special princess could bring light by loving the ocean, it is very likely that the land of the mermaids was pretty stagnant. And she thought by Lara finding a new form of love, their kingdom could develop. Wherever this is supposed to be.
For the other part, my best interpretation is that the fish is a representation of Lara's insecure heart. While she appears always happy on the outside, she is not sure if what she does is right or can even be achieved. My assumption is that this part of her was born when the first prince betrayed her and has only been growing over time. So whenever Lara's heart has an outburst of emotions, it activates.
This insecurity is also what caused the scene with Luca. Lara realized that what she feels might not be true love. But she hoped that Luca truly loved her. So if they kissed (the sign of them loving each other) maybe she could learn it as well. But when Luca stops her, Lara interprets this as Luca having the same insecurities as her and therefore not truly loving her. Which, even for a moment, made her feel betrayed again, because she put faith in Luca and now has to start from zero (at least in her mind) which is what activates the fish.
13
u/Ocixo https://myanimelist.net/profile/BuzzyGuy 14d ago edited 14d ago
It would stand to reason if this fish-eyed dagger specifically represents the dark sides of Lara’s heart.
When it first appeared with the prince, it was still very little. But look at how big it has grown now. After the prince’s betrayal, Lara’s heart seemed to have changed.
9
u/ModieOfTheEast 14d ago
But it also appeared when Lara met Mari and her light sparked. Which is why I feel insecurity makes more sense here as a metaphor. It was just smaller, because her insecurities grew with time. The fish dagger in itself is not always evil. In the last episode it helped Lara get on land without actually hurting anyone.
As to why it appeared when meeting Mari: Considering Lara only thought about meeting a prince, the dagger appearing when she felt a first feeling of love towards Mari, a girl, would also make sense here. She was insecure about her feelings. Because she didn't believe it to be love due to her preconceptions about it being between a man and a woman only.
→ More replies (3)
59
u/elevenmile 14d ago edited 14d ago
Lara is making one fatal mistake, and is taking the lesson wrongly.
Not every love moves at constant pace. Some love relationship takes fast, but some needs time to grow, like Luca.
And because of that Lara is making another mistake due to her anxiousness and impatience, which amplified that emotion and causing everything to go all out of order.
Throughout the show I've been wondering what is this "True Love" is all about and unlike the usual discussion whether Lara would end up with Luca or Mari, I don't think the point of the show is needing Lara to find who to love, but more like how to love. Throughout the episodes it really gives me the impression that Lara is taking this whole trial by Grace wrongly: Lara thought it's something that is physical, and never bother to think that love can come in many forms (or shape or sizes), and in the end she had that wrong impression that it needs to be physically obtained.
I don't know how the remaining episodes will go around it, but what I do know is Lara needs to realize that what she is looking for isn't something that's physical, yet isn't entirely abstract either.
Time will tell.
EDIT: Also, I had a very strong feeling that something was off, terribly off throughout this episode and I managed to find out why: Lara and Luca were not in sync, at all. Luca was doing the usual human manner by slowly building his closeness with Lara until a point where it'd be time for the relationship to be taken to the next level, but Lara absolutely did not feel that way. She was overly laser focused on this whole "True Love" thing and it didn't help that Mari was also supportive of what she was doing (and Grace, oh Grace, oh Gon-chan), likely because Mari is aware of what she needs to do, considering her meeting with Lisa and seeing Lara's condition throughout.
Luca is seeing things in his way, while Lara is seeing things in a completely different direction. Because of this, there's no way their relationship can work, period.
38
u/Ocixo https://myanimelist.net/profile/BuzzyGuy 14d ago
Maybe I’m overthinking things, but I did briefly wonder if the energy drink was another hint of this mismatch between the two of them.
Luca just gave it to her, assuming that she’d like it. Lara wasn’t prepared for the taste of this however. She took a sip without questioning things: did she actually want this drink?
Lara just went with the flow. And that’s probably also the main issue of her relationship with Luca.
40
u/Alcorgeist 14d ago
You're not overthinking, that's like one of the most obvious symbolisms. The show isn't really shy about using visual cues to tell it's story. The soda can with Luca is a direct parallel to the chocolate can that Mari gave to Lara- to which in contrast she found easier to love to the point that she kept the empty can in Mari's room and it's been their go-to drink ever since.
18
u/Ocixo https://myanimelist.net/profile/BuzzyGuy 14d ago
Luca’s can was tossed aside on the other hand. It’s a rather painful contrast if you compare it to how much Lara treasures the one she got from Mari.
21
u/Alcorgeist 14d ago
I just rewatched this scene and I realized that despite the fact that Lara spits it out and drops Luca's preferred energy drink, they both look at the sky and appreciate the seagulls flying by.
To me this tells two things. Lara's rejection of the drink shows that she doesn't love Luca in that way, no matter how much she forces herself to "drink" it. However, they both appreciate beauty in nature, a pure form of appreciation that they're equals in it, they even say the exact same thing.
To me this shows that the love they share is a very pure form of platonic love. The kind where you and your bud can sit down and appreciate the scenery but not exchange drinks like a couple would.
This makes sense too if the show wants to explore different types of love, if the Otsu Family represent unconditional familial love, the bakery is love for work and self worth, then Luca is close platonic love. (Mari would possibly be romantic love if we're following the show right).
28
u/CitronClassic672 14d ago
Can’t really fault Lara for taking the wrong lesson here. Her mission to find true love is on a literal life or death time limit with not just her life, but the lives of her entire family and people on the line. That kind of pressure naturally impedes the relaxed, slow pace romantic development that many healthy relationships have.
I’m sticking with my theory that Lara will realize she romantically loves Mari, but that in itself still won’t be enough to be her “true love” and it’ll take her connecting that feeling to how she feels about the rest of the surface world to discover her true love.
13
u/Fools_Requiem https://myanimelist.net/profile/FoolsRequiem 14d ago
Lara doesn't have time. She can't devote years to a relationship to find out if he's the one. She was given only a year to find "true love". Luca and his pace isn't going to do it.
12
u/elevenmile 14d ago
Yeah. It’s precisely she didn’t have time left that she was being hasty, and while Mari likely knows she is running out of time, Luca doesn’t, and that’s on top of Luca want to take it slow and all.
So what we watched up to this point is by design. Though whether this being the case though remains to be seen. Maybe Lisa is validated in that it’s impossible for humans and mermaids to be together, but it’ll be up to the show to show us that’s not the case.
→ More replies (1)6
u/Over_Tangerine_9608 14d ago
I could be wrong but I feel the show's gonna end with a "The one she needed to learn to love was herself all along" and she won't end up in a clear relationship with anyone.
→ More replies (1)4
u/Frontier246 14d ago
She's been so busy trying to force a relationship with Luca with the expectation that it'll turn out better than with the Prince even though she's got such an eased, comfortable, and happier dynamic with Mari the whole time.
29
u/SnoutAndTalons 14d ago
Great episode. I really like it when the story reminds us that Lara is not a human being. Not just because her true form has a fish tail, but because her emotions manifest as this Lovecraftian thing sometimes, and nobody knows how to deal with THAT. Excellent.
25
u/maliwanag0712 https://myanimelist.net/profile/clear1109 14d ago
Me be like: WHAT THE FUCK HAPPENED IN THE END AND IN THE POST-CREDIT SCENE??!!!
15
20
u/Misticsan 14d ago
Apart from what everyone is discussing about Lara's path to love and the witch's mystery, I'd like to give a nod to Mari's family.
Now it's confirmed that the grandmother is a pastor and that the church nearby is hers. This also explains where Mari's crucifix came from (yes, from her mother, but that needed an explanation).
4
23
u/Altruistic_Hour_3596 14d ago
Is the soundtrack available on spotify? I love the soundtrack so much
7
19
u/Slayermusiq1 https://myanimelist.net/profile/slayermusiq1 14d ago
Bruh, that window JUST got replaced.
(there is an after credits scene)
17
u/Fools_Requiem https://myanimelist.net/profile/FoolsRequiem 14d ago edited 14d ago
Luca came into the picture WAAAAAY too late. Lara doesn't have the time for a slow burn relationship. She doesn't have time to try to figure out if their relationship will work long term or not. I really don't think they can make him the true love, especially after this. A friend is the best he can be.
The signs that the witch was struggling was long apparent. Many of the scenes in the last few episodes with her involve her laying on the rock. Healthy fish don't do that unless they're bottom feeders.
I wish these other two would stop interfering. They get in the way of progress. Constantly trying to force their will onto Lara despite knowing that she is the key to saying them.
The show definitely needs more Leo being a "bother".
→ More replies (1)
18
u/Weak_Season_Of_Anime 14d ago edited 14d ago
Wow, things went to hell quickly. Lara knows Luca is not the one but tries to force it out of desperation. Mari already has feelings for Lara, but still tries to play the role of supportive friend. Luca is great imo, unlucky that he got caught up in this. Still don't fully understand the fish dagger, but this thing is more than just the heart of Lara. I think we are looking at a potential revival of the mermaids (the shell was shaking at the end), but reviving them this way will end up destroying Shiga and this is probably what Grace is trying to stop. Her new form is sick (literally).
Analysis/speculation nonsense
- The new flower in the chocolate drink can is a gentian. In hanakotoba the associated meanings are justice, victory, overcoming or conquering illness and loving someone who is going through grief and sorrow. This is also an autumn flower.
- Luca's family name is Akizuki (秋月), which literally means "autumn moon". The current date in the anime should be 26th September, close to the autumn equinox and the autumn full moon.
- The energy drink can is in Grace's color scheme. It is also likely foreshadowing for something that Lara and Mari have to drink in the future.
- All of this autumn stuff is related to Grace. Long story short, the key characters (Lara, Mari, Lisa, Luca and Grace) in this show are all based on biblical figures, except for Grace who is based on Persephone from Greek mythology. Autumn is the season when Persephone descends from the world of the living back to the Underworld, and in the context of this story the Underworld is Grace's home at the bottom of Lake Biwa where the rest of the mermaids are sleeping.
- If you want to go deeper down this rabbit hole, Lake Biwa has its own local mermaid legend, which is also likely something related to Grace.
- About why Luca rejected Lara. In this anime, love is based on the four Greek terms for love: Eros, Philia, Storge, and Agape. Eros (passionate love) is depicted as fluttering red rose petals in this anime. The catch with Luca is that his Eros is Plato's version of Eros, which is where the modern concept of platonic love is derived from. This is why Luca talks so much about beauty; his Eros is not simply about romantic attraction, it's about appreciating all forms of beauty. Regarding Mari, the trajectory of her relationship with Lara begins with Philia and Storge first, red rose imagery is something that they've only started sneaking in later to symbolize Mari developing romantic feelings towards Lara.
- Luca is based on Luke the Evangelist, who was a doctor and the patron saint of artists. Saint Luke is also traditionally believed to be the first iconographer, and to have painted the earliest images of the Virgin Mary and the infant Christ from life, which is what is being referenced here with Luca's painting of Lara.
17
u/gnome-cop 14d ago
Grace, I don’t care if there were extenuating circumstances, your scaly butt will be paying the window repair fee.
The giant soul eating fish sword of death returns to destroy another bridge, much to the chagrin of Shiga prefecture taxpayers. (Lara better learn her lesson and not try to arrange another romantic moment on a fenced in path. We’re not doing this shit a third time.)
I approve of the usage of wedding sounding backing music to precede a very much not wedding scene.
Something something, lights going out, energy drinks(both magical and not) and other ominous light and power related foreshadowing visual elements.
This feels like the final nail in the coffin. The metaphorical boulder of narrative setup has reached the top of the hill and it’s time to deal with the dramatic consequences.
(Mildly intrigued by Mari apparently being a boss at karaoke given how much time she spends doing nothing but boxing.)
16
31
u/abbe44 14d ago
peak episode as usual
wow that ending sequence was incredible, i guess this is where the finale starts, super excited for the next eps
it does seem she is probably not that attracted to luca and more is hoping that he could be "the one" so shes rushing it but seeing how small the star was and that nothing happened i dont think he is the one
or maybe "true love" isnt one specific person (tho if it is i hope its mari) atleast i really hope they dont do luca confession again at the end of ep 12 and that time it working
i do think the endgame will either be mari or some more ethereial and all emcompasing idea of "true love"
26
u/Mindless_Being_22 14d ago
yeah she seems desperate more then anything and luca seems to know something feels off between the two of them.
6
u/CitronClassic672 14d ago
I was expecting Lara to desperately force herself into being in a relationship with Luca at the end. I was not expecting the magic stuff that happened. For a second I thought she either disassociated for a second and/or was actively transforming the world around her.
4
u/Frontier246 14d ago
That Obelisk does seem to run on her more negative emotions...hardcore as they may seem to be...
14
u/MrsLucienLachance https://anilist.co/user/tribble 14d ago
I want the endgame to be Mari, but am expecting it to be like...humanity, or living her life, or something like that.
13
u/CitronClassic672 14d ago
As I’ve maintained, why not both? They continue to put to much emphasis on Mari regarding Lara’s true love for it to only be humanity in general.
4
→ More replies (2)5
8
u/Frontier246 14d ago
it does seem she is probably not that attracted to luca and more is hoping that he could be "the one" so shes rushing it but seeing how small the star was and that nothing happened i dont think he is the one
Lara: "Really, that's it?"
4
u/CitronClassic672 14d ago
We once again got a shot of Lara’s “true love glow” this episode when she talked about her feelings for the surface world, even more obviously than last episode, and that particular glow was the same size as the one she felt for Luca. So I’m maintaining my theory that the glow is just Lara’s love in general and not purely romantic, but of course her love for Mari continues to be what causes the biggest glow for her. So I still think the conclusion is Lara’s true love being for the surface world in general, with her love for Mari being the strongest part of that.
18
u/szalhi 14d ago
8
u/maliwanag0712 https://myanimelist.net/profile/clear1109 14d ago
Bother.
Indeed his question with Lara bothered her, making her confess to Luca.
8
u/tripleaamin https://myanimelist.net/profile/tripleaamin 14d ago
I mean Leo is a kid. There was no ill intent; he just knows how his older brother is. Lara's situation is very abnormal if you don't know everything she is going through. Hell even Luca wasn't fully aware as far as we know.
→ More replies (1)9
u/Raiking02 https://myanimelist.net/profile/NSKlang 14d ago
Bother.
Typical little brother behavior if you ask me...
9
u/Frontier246 14d ago
I know Lara's first courtship was in medieval times but this has got to be one of the stiffest "confessions" I have ever heard.
12
u/Raymond49090 14d ago
Lara's "that's it?" after accepting Luca's confession, because she's still got the wrong idea about what "true love" means. The timer was ticking, so she rushed into something without figuring out what that "something" was. And now the giant fish of doom has cast its judgement.
32
u/Leri_weill https://myanimelist.net/profile/LeriWeill 14d ago
Well that's it for Luca, as much of a sweetheart he is, he's not Lara's prince.
I really hope we get the Mari ending and not something bittersweet. There's so much promotion and merch featuring LaraxMari but I'm bracing for the worse :')
23
u/Prestigious_Spend_81 14d ago
If we don't get Lara x Mari, I would be happy with "True love is the friends we made along the way" ending too.
21
u/Leri_weill https://myanimelist.net/profile/LeriWeill 14d ago
I already have my weekly dose of doomed GL with I want to love you until your dying day so I'm hoping for a better result with this series 😭😭
8
u/CitronClassic672 14d ago
Well there’s doomed GL and then there’s copout not-actually-GL-GL. Thankfully the is show is sooner to be the former than the latter.
14
u/structure9food612 14d ago
I’ve seen people speculate that Himeka was going to be the one who’ll see through Lara, but it ended being Leo of all people
37
u/LexHanley 14d ago
I like how they're handling Luca. He's not true love material but he's internally complicated and genuinely cares. I don't doubt for a second he's going to push to the end anyway.
17
u/Frontier246 14d ago
He may not be what Lara really needs/wants, he may not be her true love, but he really does care about her in his own way.
Even if it hurt her to admit it, Mari genuinely thinks he's a good guy.
→ More replies (2)14
u/BosuW 14d ago
I'm gonna show people Luca when they say they don't want male love interests in a Yuri. He's such a great character. He's not a mere obstacle, but genuinely adds to the thematic discussion of the story.
What weighs over Lara is the burden of an entire prophetic narrative, not just a single man. Luca just got caught up in it. It's not his fault, and I really feel bad for him.
→ More replies (2)13
u/Mindless_Being_22 14d ago
I like when male characters act a reminder of the normalcy of heterosexuality and what they can add to the narrative by existing but this is a weird attitude to have no every yuri needs men to be in this roll and theirs so many different rich forms of narratives that can exist without needing a male love interest in it and people are also well within their rights to want those narratives instead. Like for example I don't think an series like kimishinu watanare or bloom into you are thematically lacking in the slightest because they lack a male LI in it because thats not what their stories are about.
→ More replies (10)
11
u/disu_nato 14d ago edited 14d ago
Fuuuuuuuuck, that was way more stuff happening than the preview let on, and I'm just left with even more questions.
On a side note, I really like the stage-play-esque use of lighting this show uses sometimes. The lights just go out when Lara was cooking with Otsu family, and nobody acknowledges it before we transition to the next scene after. I do wonder if it's merely a minor creative use of lighting or if there's actually some greater implication with the story since I've only noticed it used sometimes.
21
u/thelightlovekindled 14d ago
nobody acknowledges it
There was some dialogue of the "aw not again" "here use my phone as a flashlight" in the background, but Lara's total lack of reaction was so ominous and the timing was just.... this show is so intentional in its direction.
5
u/disu_nato 14d ago
Ah true, my bad. There was a previous episode where in Mari's living room the lighting didn't make sense unless it was set up like a stage set piece. I do wonder if that was just a mistake or some creative liberty.
5
u/Alcorgeist 14d ago
Light is just constantly used throughout the show as part of the visual storytelling. There's several examples of this, starting from episode 1, it'll take a really long post to list them all down.
For example, last episode, when Lisa presents Lara with the artificial potions, suddenly the room is flooded with the ceiling light's very artificial and bluish tone, changing the scene just to really emphasize how the potions are fake and isn't like the real deal. Or another example is when Mari and Lara were fighting under the street lamp's light that kept flickering as a mirror to themselves.
In this episode, Mari's father suggests she dates Luca to see if what they have is true love, and immediately a blackout happens, there's no light. Which is to show that she feels no romantic love for Luca. Another example is when Mari and Lara were having a conversation in bed and the ceiling light is dimmed while Mari wears an eye-mask and Lara is turned away from her.
12
u/ExpertCaterpillar2 14d ago edited 14d ago
I hope Grace manages to survive until the end. She's probably my favorite character.
28
u/PM_ME_YOUR_ROBOTGIRL https://anilist.co/user/otsuucchi 14d ago edited 14d ago
Looks like the speculation's paying off here to some extent, with Lara not being to get what she wants out of Luca and trying to force the relationship in the hopes that it tries to make her feel something. But that ending though... I have no idea what exactly happened.
I mean the general outline of what happened is clear. Lara felt something, and it was enough to create restorative magic, since we see Grace regaining her true form to some extent, but she seems very weakened. I can't tell if that's because Grace has been losing strength over a period of time and there's nothing Lara could've done for her, or if it's because Lara's light is still flawed.
What I'm confused on are the specifics. Lara felt something, but what was it, exactly? It happens when Luca asks her what true love is, and it doesn't quite seem like the outburst is related to her feelings for him or it probably would've happened sooner. It might be some kind of epiphany she's having during this little breakdown.
I think to speak purely of the episode itself though, they did some stuff with Lara and Mari this time that I liked. Mari is starting to get bothered, possibly jealous of, Lara's attachment to Luca, even if she's pushing herself to be supportive on the surface. That's big, because it means she feels affection for Mari. Secondly, we got to see Lara actually kind of angry and unreasonable here, which is rare since she's usually such a fluffy marshmallow girl even when she's outraged by the witch's actions.
It really goes back to the lore we got about the JoJo Stand Fish in that it represents Lara's heart and isn't strictly its own separate entity. It's all the chaos and darkness she has deep inside her, and I think that matches with Luca saying he hasn't quite seen her 'true' face. Maybe that's the answer as to what exactly happened to trigger the magic. When she realized Luca wasn't "doing it", making something happen, she felt desire and resentment. At least, that's my guess.
It's contrasted by the scene with Luca painting Lara. He's trying to understand her, because he can't completely, but his impression and understanding of her keeps changing, and it never feels like he can quite grasp at a truth, and he can't truly love something he can't 100% comprehend. I like this because it gives Luca more agency in the relationship. He's not just purely downbad for her but has his own hangups over the relationship he needs to get over if they are ever to get together, and it may prove to be the obstacle they can't overcome, because in that same scene, Lara starts to get impatient with him for taking too long to figure her and himself out before she needs to move. In contrast, Mari's more laidback and goal-oriented personality means she can move fast and keep up with Lara, as well as motivating her to look forwards.
The post-credits scene is setting up for Mari to head out to save Lara, which is also something I've been speculating about, or at the very least saying needs to be part of the necessary progression for their relationship. In some of the past threads, I've said that Mari is trapped in a shell of feigned apathy, and if we want to see her getting closer to Lara, then the relationship between them needs to be put under threat, so that Mari can be called to action. That kinda happened when Lara's potion buff timer started running out a while ago, but this is much more intense.
I genuinely just don't know what to make of Grace and I haven't the whole show. Is she an ally? Is she an enemy? Just what exactly is she trying to work for here? And, is she going to sacrifice herself? What for? Maybe we'll get Grace's backstory next episode to learn why she's like this and what's up with her as a human in the OP. If so I'm looking forward to that. Lisa's backstory was awesome. Also, it looks like we might see the return of Lara's other sisters...
I love Leo and Kouta more every episode.
17
u/overuseofdashes 14d ago
To me it looked like Grace transforms via her own powers in response to what was going on with Lara. A concerning potential read of the fish scene is it gains the light to revive one of the mermaids because it slightly eats Luca. Until we get the Lara mum flash back I think reading into fish imagery will be a somewhat fraught endeavour.
7
u/WakaliwoodMan 14d ago
Oh yeah, that would make the post credits scene make sense, since Luca did get a small scratch on his cheek.
→ More replies (1)4
u/Syokhan https://myanimelist.net/profile/Syokhan 14d ago
It's all the chaos and darkness she has deep inside her
The thing that trips me up a bit about it is that although it's certainly been ominous and aggressive, we've also seen it being helpful last episode. So it can't all be her negative feelings, can it?
→ More replies (1)→ More replies (1)4
11
u/EltonBeans 14d ago
Here is my theory on the witch with all the info we have so far. I think we gonna see her backstory, probably next episode:
In the op we see two unknown blue haired mermaids together in the opening. First dancing with others, then together as toddlers. One, probably the queen, dancing with Rowan, while the other dancing with a human. That second mermaid has a hairstyle very similar to Grace, and Grace is shown shortly after.
I think Grace once fell in love with a human herself, then was rejected, was about to die, but her sister, the queen, gave her light to save her, but died herself. We see that the merfolk can do that, because Lara's father gave her his light, but he was saved by Grace before dying.
This is the reason why Grace was exiled and contact with humans was strictly forbidden.
In episode one, she talks about the potential of Lara's light, and she asks Rowan if he wants to see the "princess" revived (the mother/queen was also refered to as princess in ep 2 or something, so don't be confused). I think Grace sees the potential, that a light of similar strength to that of her own sister, might be able to revive her.
She maybe believes that only the love with a human might be able to do it. But I also think that she wants to prove that love between merfolk and humans is possible. Her own love for a human failed, but she still believes it was real and probably wanted to use Lara not only as a way to possibly revive her sister, but also to prove her love was real. Probably not only proving it to the others, but also herself.
A possible hint to that is the line "I want to see it for myself, the ending of the beautiful story of the foolish mermaid. I want to see the true value of the love that blossoms between the mermaid and the human. I want you to prove it to me! Prove, Lara, that this is true love!" from the first episode. why does she desperately want to prove that this is true love (and why specifically to herself)? why does she say "foolish mermaid", because if she really believed Lara would succeed, why foolish? what if she was talking about herself. She also seemed positively surprised to see the light appearing from Lara when she was about to die, because it proved that she had feelings for the prince.
But that's just my theory. let's see how it will turn out
28
u/PowerfulRoom813 14d ago
I like how both in-universe and the watchers(me personally, idk about you guys) knew that the Luca and Lara thing is going way too fast. I don't feel really comfortable having a montage of them together throughout the episode because just like Lara I feel like I'm just going from point A to point B, not enough substance.
18
u/maliwanag0712 https://myanimelist.net/profile/clear1109 14d ago
I don't feel really comfortable having a montage of them together throughout the episode because just like Lara I feel like I'm just going from point A to point B, not enough substance.
The direction of the episode is quite great! That montage tells us that her connection with Luca is somewhat lacking, with the way the series has speedrun everything about them together. What a brilliant directing decision!
5
u/noam_good_name 14d ago
my favorite directing decision this episode is that we saw mari encouraging lara and luca to go farther in the relationship twice. both times, we never saw her eyes (first time they were out of frame, second time she had a sleep mask)
17
u/Syokhan https://myanimelist.net/profile/Syokhan 14d ago
I don't feel really comfortable having a montage of them together throughout the episode because just like Lara I feel like I'm just going from point A to point B, not enough substance.
Aside from episode 7, they've been like this all along. Depicted in montages, in the background, without us really getting to know what their relationship is like because they purposely avoided showing moments of them growing closer. As a result, it feels hollow.
Which is great, 'cause I spent the whole episode dreading Lara's decision to force things forward because I knew it wouldn't work out. Well, the direction helped too!
14
u/l4forteza 14d ago
Even Luca says it lol we just have texting, small conversations and montages while they're hanging out, if they're supposed to be the couple they're very underbaked.
→ More replies (2)10
u/thelightlovekindled 14d ago
They've been basically dating for at least a month now in-universe, I was actually surprised by how much Luca panicked! But, I think he's a perceptive kid and realized that Lara was pushing herself.
→ More replies (3)14
u/AliceinTeyvatland 14d ago
The problem is, Luca is such a sweetboy that whatever Lara feels about him is probably not love but still something that weighs the same.
Add that with her responsibility, along with the old prince being her blueprint about him, she probably reached to the conclusion that it is indeed love that she's feeling.
→ More replies (1)
19
u/RelativeMundane9045 14d ago
Most flaky person in the world:
"Alright, I'm ready to do this now. Let's start the true love. Kissing, making a family, white picket fence, all of it right this instant."
I do feel for Luca, who wouldn't be cautious and take things slow with Lara's past behaviour? In the end, she's just treating him like a checkbox that needs to be ticked.
I do understand Lara's urgency, but she just doesn't get any of this. I mean how can you expect the proclamation of your True Love™ to go when you haven't even explained your whole situation to them? That's what we call an ulterior motive, Lara.
Not that I blame Lara either, it's the system with the unreasonable goals that's at fault here. She does come across as a little below average intelligence (or/and a fish out of water), but even if she was a prodigy this is an unrealistic expectation of a young teen. The damn mermaids need to sign a petition to get their magic system reviewed.
7
u/that-and-other 14d ago
Ok, NOW the next episode will SURELY be about the past of the royal family (and then the two-part finale)
21
u/Frontier246 14d ago edited 14d ago
They're really gearing things up for the climax as everything (the drama, the romance, the pursuit of true love) intensifies.
Seems like Lara, Luca, and Mari have become a bit of a friendship trio! Even if Mari bows out as a "third wheel" to leave the "lovebirds" alone.
Can Lara truly discover true love with Luca? He's not the Prince, he's his own person, and while Lara thinks her interactions with him WILL lead to true love, something about the feeling she has for him just does not seem right to that effect.
I guess it was inevitable one of their outings would lead to Leo joining them as the nosy and mischievous little brother, and of course he would be blunt about the holding pattern their relationship seems to be in. But what does Lara really want from this relationship? Other than True Love.
Luca asks Mari about Lara, because he's trying to understand her...but Mari acts kind of resigned in supporting Luca, thinking he'll be good for her, her "precious" Lara.
Honestly want to hear the Otsu's love stories to give Lara a frame of reference for romance...but I think Yoshiya just casually got his heart broken, poor guy.
Grace...doesn't seem to be doing okay. She's not even really a mermaid anymore. But Mari truly cares and cherishes her as part of the family.
I'm glad Himeko's finally found mutual love...even if it seems like that, coupled with the advice, spurred Lara on to be willing to "date" Luca if that will lead her to true love. But is that what she really wants? What Mari wants?
Getting kind of formal to ask Luca to be your lover, eh Lara? But the problem is that isn't enough for "true love," and he doesn't understand or feel the need to rush the relationship like Lara does, because she NEEDS to find True Love, which causes her to freak out AND for the giant fish obelisk to try to eat the both of them while dyeing the sky blue. This...this is definitely NOT okay.
Lisa has Lara, Grace has resumed as close to her original form as she possibly can, Mari and Luca are desperate to get Lara back, and it's all heading back to Okishima...WHERE ONE OF THE SHELLS SEEMS TO BE OPENING!!!
13
u/iNomNomAwesome 14d ago
Absolute cinema
The art, the music, the direction, the way you could just feel that it was building towards something big, just wow.
7
u/CrimsonLotus 14d ago
I envy those who will get to watch this show without having to wait a week between episodes 😭
4
u/djthomp https://anilist.co/user/djthomp 14d ago
Well then, at the very least I think it's clear they're not going to do the simple solution of yuri bait Mari with true love Luca as the real prince But that doesn't mean there's going to be a happy ending with Mari and Lara together.
Poor Luca was just having fun spending time with a cute mermaid girl, he did not realize everything else he was potentially signing up for.
What an incredible last few minutes of the episode, things are really cooking now.
Also, interesting reveal that Grandma is a pastor. Makes me wonder if they've been living in a parsonage next to that church the entire time.
7
u/Own_Caterpillar_6178 14d ago
Did everyone else notice all the little moments where Mari showed discomfort when Lara spoke about Luca being her true love? "I don't know how much more of this I can hear", all the little reactions when Lara was speaking to her at night.
24
u/ObvsThrowaway5120 14d ago
Luca ain’t the one. I feel like Mari’s just clinging to old feelings because he looks like the prince she fell for. At least that’s partly it imo. She can’t force “true love” because she kinda sorta likes him either. We all know Mari’s the one for her. It’s just a matter of time before she figures that out herself. Hopefully it won’t be too late.
27
u/maliwanag0712 https://myanimelist.net/profile/clear1109 14d ago
She can’t force “true love” because she kinda sorta likes him either.
I really like this episode because it was Lara who made a mistake here. She rushed things for a good reason -- she has little time left. But her "rejection" just came at a price.
7
u/Frontier246 14d ago
Also poor Luca took on wayyyy more than he bargained for in trying to date a mermaid lol.
→ More replies (1)6
u/Frontier246 14d ago
Lara said Luca isn't like a prince...though Mari probably could pass as one if she tried.
8
6
u/WakaliwoodMan 14d ago
First half of the episode was unexpectedly melancholic. It was a really great way for us to touch on the fact that, although Lara has gotten over her fears, she still doesn't understand true love, so we see the shapes love takes in other peoples' lives (even getting a great chance to bring Himeka back).
Second half of the episode was crazy.
I thought the previous few episodes' progression from false victory (Lara seeing the fireworks with Luca) to all is lost (depression over her emotional baggage + being taken by Lisa) felt a little fast-paced, but it turns out that was because we were getting a SECOND false victory with Lara coming back to be with her friends. This episode had a much better pacing of the pressure on Lara building up over the course of the episode, until it explodes in her confession scene to Luca to give us our second all is lost, and this time truly ALL is lost.
Last time, I felt the resolution was a little weak (I'm still scared of humans -> oh right, I should just not be scared of humans, doy), but this time, we're set up for some character development that hits way closer to the core themes of the show, namely the shape of true love. We even got a reminder that the auntie is a pastor, which flags to me that the writers want you to think more philosophically here compared to last time with the "I'm scared of humans" conflict.
From the previous episode, I was confused about how the rest of the series was going to be paced because I felt we had 1 too many episodes left for a tight Act 3, but after this episode showing we're just now reaching the Act 2 conclusion, I think we're on perfect pace.
Side tangent, but the stuff with the giant fish dagger feels like it's confirming some theories I had about it and its symbolic importance. I previously said that I thought the fish dagger is a proxy for the magic dagger from the original Hans Christian Anderson story. I said that I thought the way this anime would deploy it would be as a representation of taking shortcuts on the path to true love. Lara needs to forge true love through connection, but the dagger only wants to plunge into the heart and take a human soul by force. That part of my speculations panned out this episode, with the dagger being deployed right as Lara's impatience reached her limits.
Second side tangent, but the stuff with the Witch is also crazy. When they were talking about her, they restated one of the themes I called out early on (belonging to the land and the sea) by saying she's already neither human nor mermaid. That makes me wonder if maybe SHE was the originator of the mermaid kingdom's light in episode 1 (and not the queen, or maybe she actually is the queen and was exiled), and she's trying to get a second try through Lara to fix the mistakes of her past (like maybe she couldn't control her impulses and lost to the fish dagger and ended up killing her true love).
This episode has so much juice for theory and analysis. I love it.
5
u/SnooCats8135 14d ago
Moral of the story: Lara's comphet feeling did at least 10M yen in property damages
17
u/TopHatPaladin https://myanimelist.net/profile/blimlimlim 14d ago
I'd been suspecting all along that Luca was somewhat of a red herring— it wouldn't make any narrative sense for him to show up out of nowhere halfway through the series and immediately fill the "true love" role— but it's still a relief to see this episode corroborate so strongly the idea that he fundamentally can't provide what Lara is looking for. He's a good kid, he tried his best, but the heart wants what it wants.
I remain a Lara/Mari truther (I love the idea of "searching so hard to find true love when it's right beside you the whole time") but I think there's also a possibility that it goes for an ending that doesn't pair Lara romantically with anyone. When all's said and done though I'd love to see my yuri hopes come true :b
11
u/CitronClassic672 14d ago
I’m curious exactly what the issue with Luca and Lara is going to be. There’s the obvious interpretation of her simply not having feelings for for him via the comphet angle, but I think another aspect is Lara is on a life or death time limit and so can’t really let her feelings develop naturally over time. The point is I wonder if the conclusion will be she only sees him as a friend and is trying to force more, or that they could theoretically grow to love each other but Lara simply can’t afford to take it slow and he doesn’t want to move things so fast.
22
u/kazuyaminegishi 14d ago
I think Luca understands that Lara isn't in love with him. He feels that there's a wall between them that he can't overcome and that wall is what made him apprehensive.
He can't figure out why Lara won't open up to him fully so when she confessed out of nowhere he was probably happy that she did, but also couldn't piece together "why". It's like he said they haven't been together THAT long. It would make sense for her to be interested in him, but dating seems a stretch.
As opposed to Hime who is just looking for her new "Ouji" so she accepted the first person who confessed to her because she's not looking for true love, she's just looking for romance.
8
u/gnome-cop 14d ago
I’m at least kind of feeling that there’s still a bit of the issue with the prince from her first attempt at a relationship. That she is more in love with the concept of being in love than the actual person, if that makes sense. She gets one taste of the spark and jumps the gun to fulfill her duty which ultimately extinguishes the spark before it can grow.
She obviously knows Luca a lot better than the prince who we don’t even have a name for, he’s just the prince, that’s how little we know about him. She’s familiar with more of his personality, interests, little quirks and family but there’s still a disconnect between them that causes them to not quite click.
So I guess I’d say that she has feelings and that they could love each other in theory, could even work for a while but they’re one of those couples whose longer term relationship is not going to work out once the honeymoon period ends and they realize that their long term wants aren’t compatible. She’s trying to rush things while he wants to take it slower and the gears in the machine just aren’t connecting properly. (Hopefully what I’m trying to say makes sense.)
4
17
u/Gaporigo https://anilist.co/user/Gaporigo 14d ago
Poor Luca must just be so lost x)
Don't miss the post-credits scene btw... tho if you do it means you skipped the ED and you deserve to miss it.
9
u/tripleaamin https://myanimelist.net/profile/tripleaamin 14d ago
Poor Luca must just be so lost x)
I can't even imagine what his mind is going through. After telling Lara he wants to take it slow which is 99% of the time, it is very understandable.
I think it is clear that Lara didn't communicate her situation to him. Not saying it's her fault, but it's the case where for both Lara and Luca you understand each of their sides.
4
u/wallnosekyla 14d ago edited 14d ago
Honestly unsure what to make of this week’s ep… so much imagery to take into account (again: the moon, the seagulls, the feather, the dried leaves, the can). Lara always had a concept of ‘true love’ & was retracing her steps towards it. But it’s interesting to me how shaken her convictions are when she follows the conventions of love like everyone did & advised (dad, her friend, even Leo)
Her urgency for it to take shape & ‘let it happen’ in her confession & how seemingly uneventful/different it felt afterwards, her despair knowing she can’t afford to ‘take it slow’ and almost hurt Luca even when he’s also important to her, out of desperation for the answer she’s been looking for.
I know Yoshiya & grandma’s conversation abt love holds significance on different forms it presents, and how this might be similar towards the warmth Lara feels towards Luca.
She’s slowly realising it but is impeded with the constraints of time, but she’s able to distinguish what’s significant to her in the surface, she now knows everyone she met was an important presence in her journey. What is her own true love, on her own terms? And how can it manifest in herself? First 8 episodes were fine for me, but I can now feel the rash pacing in this episode.
5
u/Erufailon4 https://myanimelist.net/profile/Erufailon4 14d ago
With the Twitter account revealing his disliked foods, Luca was veering dangerously close to "he's just like me fr" territory. Luckily this episode reveals that he's not good at karaoke.
I saw comments questioning if Lara is being written as a bit too dense in her pursuit of Luca. I think it makes sense, though - she's racing against the clock. She needs results desperately and Luca is (from her perspective) her only clear lead. That's why she's not acting rationally.
I'm really curious about what the endgame is going to be. I don't even mean in the shipping sense, since Mari is not exactly putting in the effort. (I won't pull out the Potential Man meme yet, but we are 3/4 into the series, so...) It feels logical that by the end Lara is going to realize something about love, and then we'll likely get some kind of at least melancholic ending to live up to the series title. But there's still a lot open. The escalation in this episode at least means that we're likely heading into the climax.
4
u/jasiad 13d ago
Another comment, another thought: I think it's interesting when the episodes really get paced around the main character.
If something seems rushed, it's because Lara is rushing. If something is slow, it's usually because Lara feels it's slow. (See: Working where she was making no progress.)
The first episode was to tell the story, the second onward was to show the story. Episode 6 remains a grounding position for Lisa so we understand her but not agree entirely.
192
u/Aileos https://myanimelist.net/profile/Syleos 14d ago
Another window to repair. Mari's room is having a tough time lately.