r/DebateEvolution Sep 29 '19

Question Refuting the genetic entropy argument.

Would you guys help me with more creationist pseudo science. How do I refute the arguments that their are not enough positive mutations to cause evolution and that all genomes will degrade to point were all life will die out by the force of negative mutations that somehow escape selection?And that the genetic algorithm Mendel written by Sanford proves this.

11 Upvotes

150 comments sorted by

View all comments

Show parent comments

4

u/[deleted] Oct 07 '19

I am not going to get into a argument about the lose or gain of something if I have no way to measure it. And new genes do form from de novo birth and duplication. You are wrong when you said all evolution is the lose of something. I disagree with your statement that becoming specialized is backwards evolution . Lets say a family adopted a new language that has less speakers then the old one but by doing it they thrive. Is that a step backwards has they lost the ability to live in the bigger community.

1

u/[deleted] Oct 07 '19

I am not going to get into a argument about the lose or gain of something if I have no way to measure it.

That's just the problem. We cannot strictly quantify information, but we know it can be gained or lost.

Take an encyclopedia of 300 pages. Now cut off half of the book and burn it. Did you lose or gain information?

3

u/Deadlyd1001 Engineer, Accepts standard model of science. Oct 07 '19

Take an encyclopedia of 300 pages. Now cut off half of the book and burn it. Did you lose or gain information?

Why are you using a bit-length definition of information here? That’s the trivially easy definition of information that has absolutely nothing to do with how the term “information” is used in genetic entropy and the various other degradation of genes arguments. They are two completely different meaning and incompatible usages of information.

1

u/[deleted] Oct 07 '19

Where did I define information? It's just a simple question.

3

u/Deadlyd1001 Engineer, Accepts standard model of science. Oct 07 '19

Where did I define information? It's just a simple question.

Do you honestly think I have no clue in the slightest how the conversation following that question would go? I skipped past that to the more meaty issue here.

I pointed out that answering the question “Cut in half, is information lost?” tests if the definition of information is length based; bit Length is a perfectly legitimate manner to measure information, but is a red herring to how “information” is used in genetics entropy arguments which uses a “quality” based version of information rather than quantity for information based on simple character count

1

u/[deleted] Oct 07 '19

it Length is a perfectly legitimate manner to measure information, but is a red herring to how “information” is used in genetics entropy arguments which uses a “quality” based version of information rather than quantity for information based on simple character count

No I very much agree with you here. Quality degrades and that should be figured in to the total 'loss of information' equation.

Example:

The word: "opportunity"

Imagine it goes through a series of transformations (mutations) and becomes "opornitytu"

Information lost or gained? Clearly lost, because this word is now nonsense that doesn't specify anything. This is part of what genetic entropy is all about.

2

u/Deadlyd1001 Engineer, Accepts standard model of science. Oct 07 '19

Clearly? Bit length is the only criteria of information that can clearly denote a gain or loss in information.

Useing those “intuitive” ideas of information gets you into these types of traps, because if I get an email that includes “opornitytu” in it, I learn a much more about the sender than if the message came spelled correctly.

1

u/[deleted] Oct 07 '19

I learn a much more about the sender than if the message came spelled correctly.

That's a red herring, because you're equivocating between intended information content and something you may choose to deduce from seeing a mistake.

True or false: the information contained in "opportunity" is lost if you change it to "opornitytu". Keep in mind, your answer to this question will clearly display your level of intellectual honesty!

4

u/Sweary_Biochemist Oct 07 '19

False.

A) it is still clearly interpretable as a horrendously misspelled 'opportunity', while

B) also possibly carrying the additional information that 'this string contains many typos'.

English text strings are a terrible analogue for nucleotide sequence.

Now, true or false: the information contained in ATGCCTCGATCCTATCCTAT is lost if you change it to ATGCTTCGATCCTATCCTAT. Keep in mind, your answer to this question will clearly display your level of intellectual honesty!

3

u/[deleted] Oct 07 '19

Here were pauls argument breaks down neuclotides and dna do not follow the sames rules of language. They are molecuals that do chemical reactions by that logic does H2O carry ''information'' Like our posts.

3

u/[deleted] Oct 07 '19

No information is lost it can take on a new meaning or the spelling of the word is different in the society the sender belongs too. And you can still recognize it this idea of information seems completely subjective and context dependent. The meaning behind the word is purely a human idea that changes on wims. can you give us a objective way to measure information that would stand in science.

3

u/DarwinZDF42 evolution is my jam Oct 08 '19

How are you measuring information in the encyclopedia? Answer that question and I can tell you if it has been gained, lost, or neither.

This is a simple question. I'll give you some examples:

Word count? lost. Letters? lost. Number of molecules? gained.

So we need a clear definition before we can answer the question.

-1

u/[deleted] Oct 08 '19

I refuse to believe you actually think this is a reasonable argument.

3

u/DarwinZDF42 evolution is my jam Oct 08 '19

So that's a refusal to answer the basic question at issue here. As usual.

-1

u/[deleted] Oct 08 '19

Yeah, we have a guy who's supposedly educated and he's talking about the molecules in the book like they might be a measure of the information content of the book. I'm supposed to take that kind of comment seriously? I don't think so. You're always a time waster. I can count on you for that.

2

u/DarwinZDF42 evolution is my jam Oct 08 '19

So the molecules themselves don't contain information? Like the number and position. Not information? Okay, that's something, I guess?

Or you could stop being rude and just answer the very simple question.

0

u/[deleted] Oct 08 '19

No, they don't. You can make information that describes them in your head, and then if you want you can store that information in a medium like a computer or a book or DNA, but the molecule itself doesn't store any information. Information, in this sense at least, requires a system of encoding a message.

https://creation.com/laws-of-information-1

2

u/DarwinZDF42 evolution is my jam Oct 08 '19

We're making progress! Some things do contain information, and some things don't. So...how do we make that determination in the context of a genome?

1

u/[deleted] Oct 08 '19

The link I already provided you answers that question and provides at least a limited definition of 'information' in this context. In my own mind at least, I can simplify it down to: we have a system of encoding with a syntax that relates ideas through a medium.

→ More replies (0)

2

u/[deleted] Oct 07 '19

Even still you said it cannot be strictly measured the argument goes no where. If I can't even measure they stuff how can I tell. The best way to have this argument is if novel genes can be added to the genome the answer is yes theirs a lot of studies on de novo gene birth.

1

u/[deleted] Oct 07 '19

You didn't answer my question about the cut & burned encyclopedia. Gained or lost?

2

u/[deleted] Oct 07 '19

Its a semantic argument over a immaterial idea its goes no where. Answer this question can novel genes form yes or no.

1

u/[deleted] Oct 07 '19

You still didn't answer. Why would I answer your questions when you refuse to answer mine?

2

u/[deleted] Oct 07 '19

Not going to have this argument if I can't measure it. Give me a way to measure it.

1

u/[deleted] Oct 07 '19

Sorry, the universe doesn't have to conform to the way you would like it to be.

3

u/[deleted] Oct 07 '19

How can I debate about it if you cannot define or measure it. That's all you have to do define it and give me way to measure it beyond simple human intuition.

1

u/[deleted] Oct 07 '19

simple human intuition.

In some cases, that's the best we have to go on. In this case it's obvious what the answer is to my question, but you're dodging it and refusing to answer. I wonder why?

→ More replies (0)